Sample Prep:Article Title: Commensal enteric virome regulates intestinal carbohydrate digestion and absorption.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LB Broth hopebio Cat#HB0128 Nutrient Broth hopebio Cat#HB0108 Collagenase type 3 Worthington Cat#LS004182 Percoll Sigma Cat#P7828 Clodronate liposomes Yeasen Cat#40337ES08 Trizol ThermoFisher Cat#15596018CN DNase Sigma Cat#DN-25 Phenol/Chloroform/Isoamyl alcohol (25:24:1) Sigma Cat#P3803 Phusion DNA polymerase New England Biolabs Cat#M0530S 5(6)-Carboxyfluorescein N-hydroxysuccinimide ester Aladdin Cat#C107884 Lipofectamine 2000 ThermoFisher Cat#11668030 Critical commercial assays Periodic Acid-Schiff Staining Kit Beyotime Cat#C0142S Pan T Cell Isolation Kit II, mouse Miltenyi Biotec Cat#130-095-130 Anti-F4/80 MicroBeads UltraPure, mouse Miltenyi Biotec Cat#130-110-443 EasySep Mouse Pan-ILC Enrichment Kit STEMCELL Technologies Cat#19875 Mouse IL-22 High Sensitivity ELISA Kit Multi sciences Cat#EK222HS Mouse IL-23 ELISA Kit Multi sciences Cat#EK223 Mouse Insulin ELISA Kit MEIMIAN Cat#MM-0579M2 Mouse IL-6 ELISA Kit RUISAIQI Cat#R-S-M0007 Mouse IL-1β ELISA Kit RUISAIQI Cat#R-S-M0003 Mouse TNF-α ELISA Kit RUISAIQI Cat#R-S-M0002 Mouse Adiponectin ELISA Kit RUISAIQI Cat#R-S-M10108 Evo M-MLV RT Kit with gDNA Clean for qPCR Accurate biology Cat#AG11728 TB Green Premix Ex Taq II (Tli RNase H Plus) Takara Cat#RR820Q E.Z.N.A. .. DNA Kit Omega Bio-tek Cat#D3892-01 TruSeq Nano DNA sample preparation Kit Illumina Cat#15041877 QIAamp MinElute Virus Spin Kit Qiagen Cat#57704 QIAquick Gel Extraction Kit Qiagen Cat#28706 TruSeq RNA Library Prep Kit Illumina Cat#RS-122-2001 Ribo-Zero rRNA Removal Kit Epicenter Cat15066012 BCA Protein Assay Kit ThermoFisher Cat#223250 quick-dna fecal/soil microbe miniprep kit Zymo research Cat#D6010S Deposited data Enteric virome and bacteriome sequencing, and mouse small intestinal scRNA-seq and bulk RNA sequencing This study PRJCA029200 https://ngdc.cncb.ac.cn/gsa/ Experimental models: Cell lines Caco-2 ATCC Cat#HTB-37 Experimental models: Organisms/strains BALB/cNj-Foxn1nu/Gpt GemPharmatech D000521 RRID:IMSR_GPT:D000521 C57BL/6JGpt GemPharmatech N000013 RRID:IMSR_GPT:N000013 BALB/cJGpt GemPharmatech N000020 RRID:IMSR_GPT:N000020 C57BL/6JGpt-Rag2em6Cd6972/Gpt GemPharmatech T011534 RRID:IMSR_GPT:T011534 C57BL/6JGpt-Il22em4Cd16159/Gpt GemPharmatech T052618 RRID:IMSR_GPT:T052618 C57BL/6Smoc-Cd74em1Smoc Shanghai Model Organisms NM-KO-190772 RRID: IMSR_NM-KO-190772 Oligonucleotides Primers for qPCR, see Table S3 Sangon Biotech N/A (Continued on next page) e2 Cell Host & Microbe 34, 1–16.e1–e8, March 11, 2026 ..
Article Title: Glycolysis inhibition functionally reprograms T follicular helper cells and reverses lupus.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cyto-ID Autophagy Detection Kit Enzo Life Sci Cat#ENZ-51031-K200 RosetteSep CD4 + T cell enrichment cocktail Stemcell Tech. .. Cat#15062 NAD/NADH-Glo TM kit Promega Cat#G9071 RNeasy Plus Micro Kit Qiagen Cat#74034 TruSeq Stranded RNA Sample Preparation Kit Illumina Cat#20020596 AMPure XP beads Beckman Coulter Cat#A63880 Quant-iT TM PicoGreen TM dsDNA assay ThermoFisher Cat#P7589 Qick-DNA Microprep Plus kit Zymo Research Cat#D4074 Next Enzymatic Methyl-seq Kit NEB Cat#E7120 Fixation/Permeabilization kit eBioscience Cat#00-5123-43 CD4 T cell Isolation Kit Miltenyi Biotec Cat#130-104-454 B Cell Isolation Kit Miltenyi Biotec Cat#130-090-862 Pierce BCA protein assay kit ThermoFisher Cat23225 4 - 20% SDS-PAGE gels BioRad Cat#4561094 Kallestad HEp-2 BioRad Cat#26101 Deposited data Murine Tfh cell RNASeq dataset and DNA bisulfite sequencing dataset NCBI BioProject PRJNA1089578 human Tfh cell RNASeq dataset NCBI BioProject PRJNA1089580 Untargeted metabolomics analysis of murine Tfh cells National Metabolomics Data Repository ST004242 Untargeted metabolomics analysis of human Tfh cells National Metabolomics Data Repository ST004243 Experimental models: Organisms/strains B6.NZM-Sle1 NZM2410/Aeg Sle2 NZM2410/Aeg Sle3 NZM2410/Aeg /LmoJ (TC) female mice Jackson Laboratory RRID:IMSR_JAX:007228 C57BL6/J mice Jackson Laboratory RRID:IMSR_JAX:000664 NZW/J female mice Jackson Laboratory RRID:IMSR_JAX:001058 BXSB/MpJ male mice Jackson Laboratory RRID:IMSR_JAX:000740 WYaa male mice This paper B6.Cg-Sle1 NZM2410/Aeg Yaa/DcrJ Jackson Laboratory RRID:IMSR_JAX:021569 Software and algorithms FlowJo V10 Tree Star https://www.flowjo.com/solutions/flowjo/downloads Prism Graphpad https://www.graphpad.com/scientific-software/prism/ ImageJ NIH https://imagej.nih.gov/ij/ Metamorph Molecular Devices https://www.moleculardevices.com/products/ cellular-imaging-systems/high-contentanalysis/metamorph-microscopy STAR aligner v2.7 Open source https://github.com/alexdobin/STAR FeatureCounts (v2.0) Bioconductor https://subread.sourceforge.net/featureCounts.html DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html pheatmap R function (version 1.0.12) Datacamp https://www.rdocumentation.org/packages/ pheatmap/versions/1.0.12 Matplotlib-Venn (Version 0.11.5) MIT https://www.piwheels.org/project/matplotlib-venn/ Bismark v0.22.3 Babraham Institute https://www.bioinformatics.babraham.ac.uk/ projects/bismark/ DSS Ge et al. 84 https://www.bioconductor.org/packages/ release/bioc/html/DSS.html BEDTools v2.29.2 Ge et al. 84 https://bedtools.readthedocs.io/en/latest/ DAVID NCI https://david.ncifcrf.gov 20 Cell Reports 44, 116600, December 23, 2025 ..
Virus:Article Title: Commensal enteric virome regulates intestinal carbohydrate digestion and absorption.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LB Broth hopebio Cat#HB0128 Nutrient Broth hopebio Cat#HB0108 Collagenase type 3 Worthington Cat#LS004182 Percoll Sigma Cat#P7828 Clodronate liposomes Yeasen Cat#40337ES08 Trizol ThermoFisher Cat#15596018CN DNase Sigma Cat#DN-25 Phenol/Chloroform/Isoamyl alcohol (25:24:1) Sigma Cat#P3803 Phusion DNA polymerase New England Biolabs Cat#M0530S 5(6)-Carboxyfluorescein N-hydroxysuccinimide ester Aladdin Cat#C107884 Lipofectamine 2000 ThermoFisher Cat#11668030 Critical commercial assays Periodic Acid-Schiff Staining Kit Beyotime Cat#C0142S Pan T Cell Isolation Kit II, mouse Miltenyi Biotec Cat#130-095-130 Anti-F4/80 MicroBeads UltraPure, mouse Miltenyi Biotec Cat#130-110-443 EasySep Mouse Pan-ILC Enrichment Kit STEMCELL Technologies Cat#19875 Mouse IL-22 High Sensitivity ELISA Kit Multi sciences Cat#EK222HS Mouse IL-23 ELISA Kit Multi sciences Cat#EK223 Mouse Insulin ELISA Kit MEIMIAN Cat#MM-0579M2 Mouse IL-6 ELISA Kit RUISAIQI Cat#R-S-M0007 Mouse IL-1β ELISA Kit RUISAIQI Cat#R-S-M0003 Mouse TNF-α ELISA Kit RUISAIQI Cat#R-S-M0002 Mouse Adiponectin ELISA Kit RUISAIQI Cat#R-S-M10108 Evo M-MLV RT Kit with gDNA Clean for qPCR Accurate biology Cat#AG11728 TB Green Premix Ex Taq II (Tli RNase H Plus) Takara Cat#RR820Q E.Z.N.A. .. DNA Kit Omega Bio-tek Cat#D3892-01 TruSeq Nano DNA sample preparation Kit Illumina Cat#15041877 QIAamp MinElute Virus Spin Kit Qiagen Cat#57704 QIAquick Gel Extraction Kit Qiagen Cat#28706 TruSeq RNA Library Prep Kit Illumina Cat#RS-122-2001 Ribo-Zero rRNA Removal Kit Epicenter Cat15066012 BCA Protein Assay Kit ThermoFisher Cat#223250 quick-dna fecal/soil microbe miniprep kit Zymo research Cat#D6010S Deposited data Enteric virome and bacteriome sequencing, and mouse small intestinal scRNA-seq and bulk RNA sequencing This study PRJCA029200 https://ngdc.cncb.ac.cn/gsa/ Experimental models: Cell lines Caco-2 ATCC Cat#HTB-37 Experimental models: Organisms/strains BALB/cNj-Foxn1nu/Gpt GemPharmatech D000521 RRID:IMSR_GPT:D000521 C57BL/6JGpt GemPharmatech N000013 RRID:IMSR_GPT:N000013 BALB/cJGpt GemPharmatech N000020 RRID:IMSR_GPT:N000020 C57BL/6JGpt-Rag2em6Cd6972/Gpt GemPharmatech T011534 RRID:IMSR_GPT:T011534 C57BL/6JGpt-Il22em4Cd16159/Gpt GemPharmatech T052618 RRID:IMSR_GPT:T052618 C57BL/6Smoc-Cd74em1Smoc Shanghai Model Organisms NM-KO-190772 RRID: IMSR_NM-KO-190772 Oligonucleotides Primers for qPCR, see Table S3 Sangon Biotech N/A (Continued on next page) e2 Cell Host & Microbe 34, 1–16.e1–e8, March 11, 2026 ..
Gel Extraction:Article Title: Commensal enteric virome regulates intestinal carbohydrate digestion and absorption.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LB Broth hopebio Cat#HB0128 Nutrient Broth hopebio Cat#HB0108 Collagenase type 3 Worthington Cat#LS004182 Percoll Sigma Cat#P7828 Clodronate liposomes Yeasen Cat#40337ES08 Trizol ThermoFisher Cat#15596018CN DNase Sigma Cat#DN-25 Phenol/Chloroform/Isoamyl alcohol (25:24:1) Sigma Cat#P3803 Phusion DNA polymerase New England Biolabs Cat#M0530S 5(6)-Carboxyfluorescein N-hydroxysuccinimide ester Aladdin Cat#C107884 Lipofectamine 2000 ThermoFisher Cat#11668030 Critical commercial assays Periodic Acid-Schiff Staining Kit Beyotime Cat#C0142S Pan T Cell Isolation Kit II, mouse Miltenyi Biotec Cat#130-095-130 Anti-F4/80 MicroBeads UltraPure, mouse Miltenyi Biotec Cat#130-110-443 EasySep Mouse Pan-ILC Enrichment Kit STEMCELL Technologies Cat#19875 Mouse IL-22 High Sensitivity ELISA Kit Multi sciences Cat#EK222HS Mouse IL-23 ELISA Kit Multi sciences Cat#EK223 Mouse Insulin ELISA Kit MEIMIAN Cat#MM-0579M2 Mouse IL-6 ELISA Kit RUISAIQI Cat#R-S-M0007 Mouse IL-1β ELISA Kit RUISAIQI Cat#R-S-M0003 Mouse TNF-α ELISA Kit RUISAIQI Cat#R-S-M0002 Mouse Adiponectin ELISA Kit RUISAIQI Cat#R-S-M10108 Evo M-MLV RT Kit with gDNA Clean for qPCR Accurate biology Cat#AG11728 TB Green Premix Ex Taq II (Tli RNase H Plus) Takara Cat#RR820Q E.Z.N.A. .. DNA Kit Omega Bio-tek Cat#D3892-01 TruSeq Nano DNA sample preparation Kit Illumina Cat#15041877 QIAamp MinElute Virus Spin Kit Qiagen Cat#57704 QIAquick Gel Extraction Kit Qiagen Cat#28706 TruSeq RNA Library Prep Kit Illumina Cat#RS-122-2001 Ribo-Zero rRNA Removal Kit Epicenter Cat15066012 BCA Protein Assay Kit ThermoFisher Cat#223250 quick-dna fecal/soil microbe miniprep kit Zymo research Cat#D6010S Deposited data Enteric virome and bacteriome sequencing, and mouse small intestinal scRNA-seq and bulk RNA sequencing This study PRJCA029200 https://ngdc.cncb.ac.cn/gsa/ Experimental models: Cell lines Caco-2 ATCC Cat#HTB-37 Experimental models: Organisms/strains BALB/cNj-Foxn1nu/Gpt GemPharmatech D000521 RRID:IMSR_GPT:D000521 C57BL/6JGpt GemPharmatech N000013 RRID:IMSR_GPT:N000013 BALB/cJGpt GemPharmatech N000020 RRID:IMSR_GPT:N000020 C57BL/6JGpt-Rag2em6Cd6972/Gpt GemPharmatech T011534 RRID:IMSR_GPT:T011534 C57BL/6JGpt-Il22em4Cd16159/Gpt GemPharmatech T052618 RRID:IMSR_GPT:T052618 C57BL/6Smoc-Cd74em1Smoc Shanghai Model Organisms NM-KO-190772 RRID: IMSR_NM-KO-190772 Oligonucleotides Primers for qPCR, see Table S3 Sangon Biotech N/A (Continued on next page) e2 Cell Host & Microbe 34, 1–16.e1–e8, March 11, 2026 ..
Bicinchoninic Acid Protein Assay:Article Title: Commensal enteric virome regulates intestinal carbohydrate digestion and absorption.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LB Broth hopebio Cat#HB0128 Nutrient Broth hopebio Cat#HB0108 Collagenase type 3 Worthington Cat#LS004182 Percoll Sigma Cat#P7828 Clodronate liposomes Yeasen Cat#40337ES08 Trizol ThermoFisher Cat#15596018CN DNase Sigma Cat#DN-25 Phenol/Chloroform/Isoamyl alcohol (25:24:1) Sigma Cat#P3803 Phusion DNA polymerase New England Biolabs Cat#M0530S 5(6)-Carboxyfluorescein N-hydroxysuccinimide ester Aladdin Cat#C107884 Lipofectamine 2000 ThermoFisher Cat#11668030 Critical commercial assays Periodic Acid-Schiff Staining Kit Beyotime Cat#C0142S Pan T Cell Isolation Kit II, mouse Miltenyi Biotec Cat#130-095-130 Anti-F4/80 MicroBeads UltraPure, mouse Miltenyi Biotec Cat#130-110-443 EasySep Mouse Pan-ILC Enrichment Kit STEMCELL Technologies Cat#19875 Mouse IL-22 High Sensitivity ELISA Kit Multi sciences Cat#EK222HS Mouse IL-23 ELISA Kit Multi sciences Cat#EK223 Mouse Insulin ELISA Kit MEIMIAN Cat#MM-0579M2 Mouse IL-6 ELISA Kit RUISAIQI Cat#R-S-M0007 Mouse IL-1β ELISA Kit RUISAIQI Cat#R-S-M0003 Mouse TNF-α ELISA Kit RUISAIQI Cat#R-S-M0002 Mouse Adiponectin ELISA Kit RUISAIQI Cat#R-S-M10108 Evo M-MLV RT Kit with gDNA Clean for qPCR Accurate biology Cat#AG11728 TB Green Premix Ex Taq II (Tli RNase H Plus) Takara Cat#RR820Q E.Z.N.A. .. DNA Kit Omega Bio-tek Cat#D3892-01 TruSeq Nano DNA sample preparation Kit Illumina Cat#15041877 QIAamp MinElute Virus Spin Kit Qiagen Cat#57704 QIAquick Gel Extraction Kit Qiagen Cat#28706 TruSeq RNA Library Prep Kit Illumina Cat#RS-122-2001 Ribo-Zero rRNA Removal Kit Epicenter Cat15066012 BCA Protein Assay Kit ThermoFisher Cat#223250 quick-dna fecal/soil microbe miniprep kit Zymo research Cat#D6010S Deposited data Enteric virome and bacteriome sequencing, and mouse small intestinal scRNA-seq and bulk RNA sequencing This study PRJCA029200 https://ngdc.cncb.ac.cn/gsa/ Experimental models: Cell lines Caco-2 ATCC Cat#HTB-37 Experimental models: Organisms/strains BALB/cNj-Foxn1nu/Gpt GemPharmatech D000521 RRID:IMSR_GPT:D000521 C57BL/6JGpt GemPharmatech N000013 RRID:IMSR_GPT:N000013 BALB/cJGpt GemPharmatech N000020 RRID:IMSR_GPT:N000020 C57BL/6JGpt-Rag2em6Cd6972/Gpt GemPharmatech T011534 RRID:IMSR_GPT:T011534 C57BL/6JGpt-Il22em4Cd16159/Gpt GemPharmatech T052618 RRID:IMSR_GPT:T052618 C57BL/6Smoc-Cd74em1Smoc Shanghai Model Organisms NM-KO-190772 RRID: IMSR_NM-KO-190772 Oligonucleotides Primers for qPCR, see Table S3 Sangon Biotech N/A (Continued on next page) e2 Cell Host & Microbe 34, 1–16.e1–e8, March 11, 2026 ..
Article Title: Cereblon-based KRAS degrading PROTACs and uses related thereto
Article Snippet: Densitometry analysis was done using ImageJ software, all samples were normalized to vinculin loading control and then graphed as a percent of control as compared to vehicle treated tumors. .. Reagents for Cell Culture/Implantation DMEM—Gibco/ThermoFisher #10566016 RPMI-1640—Gibco/ThermoFisher #61870036 DMEM/F12—Gibco/ThermoFisher #10565018 DMEM (phenol red-free)—Gibco/ThermoFisher #21063029 RPMI-1640 (phenol red-free) Gibco/ThermoFisher #11835030 DPBS—Gibco/ThermoFisher #14190144 Trypsin/EDTA—Gibco/ThermoFisher #25200056 FBS—Gibco/ThermoFisher #26140079 Penicillin-Streptomycin (PenStrep)—Gibco/ThermoFisher #15140122 Human EGF recombinant protein—Gibco/ThermoFisher #PHG0315 EMEM—ATCC #302003 RPMI-1640—ATCC #302001 Hydrocortisone—Millipore Sigma #H0135-1 mg Insulin solution, human—Millipore Sigma #19278-5 ml ITS supplement—R&D Systems #AR013 Matrigel—Corning #354234 HYPER flask—Corning #10034 Reagents for Tumor Western Blots RIPA buffer—ThermoFisher #89900 HALT protease inhibitor—ThermoFisher #78437 HALT phosphatase inhibitor—Thermofisher #78420 EDTA, 0.5M—Thermofisher #1861275 BCA Protein Assay kit—ThermoFisher #23225 NuPAGE 4×LDS sample buffer—ThermoFisher #NP0007 Bolt 10×sample reducing agent—Thermofisher #B0009 NuPAGE 4-12% Bis-Tris Midi gel, 26 well—ThermoFisher #WG1403BX10 BioRad Precision Plus Dual Color ladder—BioRad #1610374 Trans-blot midi Nitrocellulose transfer pack—Biorad #1704159 MOPS/SDS running buffer—Thermofisher #NP0001-02 SuperSignalTM West Femto—ThermoFisher #34095 TBS-T (1×TBS with 0.1% tween-20) BSA, bovine serum albumin, fraction V—AmericanBio #AB00440-01000 5 mm stainless steel bead—Qiagen #69989 Ras (G12D mutant specific)(D8H7) Rabbit mAb—Cell Signaling Technology #14429S Vinculin (E1E9V) XP Rabbit mAb—Cell Signaling Technology #13901S Anti-rabbit IgG, HRP-linked Antibody—Cell Signaling Technology #7074P2 The disclosed subject matter is not to be limited in scope by the specific embodiments and examples described herein. ..
Article Title: Activation-induced SLC7A1 expression enhances T cell sensitivity to cGAMP-mediated STING signaling.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Poly-D-lysine Gibco/ThermoFisher Cat#A3890401 DMEM Corning Cat#10-013-CV RPMI 1640 Corning Cat#10-040-CV IMDM Corning Cat#10-016-CV RPMI 1640 for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88365 IMDM for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88423 Vascular Cell Basal Medium ATCC Cat#PCS-100-030 Microvascular Endothelial Cell Growth Kit-VEGF ATCC Cat#PCS-110-041 Fetal bovine serum (FBS) Atlanta Biologicals Cat#S11150 Penicillin-Streptomycin (10,000 U/mL) Gibco/ThermoFisher Cat#15140122 1× RBC Lysis Buffer Invitrogen/ThermoFisher Cat#00-4333-57 FuGENE 6 transfection reagent Promega Cat#E2691 Dynabeads Human T-Activator CD3/CD28 ThermoFisher Cat#11131D Dynabeads Mouse T-Activator CD3/CD28 ThermoFisher Cat#11452D Recombinant human IL-2 PeproTech Cat#200-02 UltraComp eBeads Plus Compensation Beads ThermoFisher Cat#01-3333-41 T-PER Tissue Protein Extraction Reagent ThermoFisher Cat#78510 TRIzol Reagent ThermoFisher Cat#15596026 Laemmli Sample Buffer (4×) Bio-Rad Cat#1610747 L-[2,3,4-3H]-Arginine monohydrochloride PerkinElmer/Revvity Cat#NET1123250UC Alt-R S.p. .. Cas9 Nuclease V3 Integrated DNA Technologies Cat#1081058 P3 Primary Cell 4D-Nucleofector X Kit Lonza Cat#V4XP-3024 eBioscience Fixable Viability Dye eFluor 780 ThermoFisher Cat#65-0865-14 DAPI ThermoFisher Cat#D1306 7-AAD ThermoFisher Cat#A1310 SurePAGETM, Bis-Tris, 10 × 8, 4-12%, 15 wells GenScript Cat#M00654 Critical commercial assays CellTiter-Glo 2.0 Cell Viability Assay Promega Cat#G9241 2′3′-cGAMP ELISA kit Cayman Chemical Cat#501700 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 RosetteSep Human T cell Enrichment Cocktail StemCell Technologies Cat#15061 SepMate-50 PBMC isolation tubes StemCell Technologies Cat#85450 MojoSort Mouse CD4 T cell Isolation Kit BioLegend Cat#480033 MojoSort Mouse CD8 T cell Isolation Kit BioLegend Cat#480035 Direct-zol RNA MiniPrep Kit Zymo Research Cat#R2050 Maxima First Strand cDNA Synthesis Kit for RTqPCR ThermoFisher Cat#K1672 AccuPower GreenStar RT-qPCR Master Mix Bioneer Cat#K-6403 Gibson Assembly HiFi DNA Master Mix New England Biolabs Cat#E2621 QIAamp DNA Blood Maxi Kit QIAGEN Cat#51194 NextSeq 500/550 Mid Output v2 kit Illumina Cat#FC-404-2001 Deposited data Uncropped Western blot images This paper Mendeley Data: https://doi.org/10.17632/ trrgvjfbx3.2 Bulk RNA-seq: resting vs. activated human T cells This paper GEO: GSE325689 Bulk RNA-seq: SLC7A1- and SLC7A2overexpressing U937 SLC19A1− /− cells This paper GEO: GSE325690 sgRNA counts from CRISPR live/dead screen This paper Table S2 (Continued on next page) Cell Reports 45, 117580, July 28, 2026 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human immune cell transcript database (DICE) Schmiedel et al.33 https://dice-database.org/ Human T cell proteomic database Cano-Gamez et al.39 https://cytokines.cellgeni.sanger.ac.uk/ Human Protein Atlas v25.0 Jin et al.40 https://proteinatlas.org AlphaFold structure of human SLC7A1 Jumper et al.41 UniProt: P30825 AlphaFold structure of human SLC7A2 Jumper et al.41 UniProt: P52569 Geobacillus LAT crystal structure (arginine-bound) Jungnickel et al.37 PDB: 6F34 Experimental models: Cell lines Human: U937 SLC19A1− /− Ritchie et al.31 N/A Human: HEK293T ATCC Cat#CRL-3216; RRID:CVCL_0063 Human: Jurkat E6-1 ATCC Cat#TIB-152; RRID:CVCL_0367 Human: TIME (telomerase-immortalized microvascular endothelial) ATCC Cat#CRL-4025; RRID:CVCL_0047 Human: OCI-Ly7 DSMZ Cat#ACC688 Mouse: BV-2 Accegen Cat#ABC-TC212S Experimental models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory Strain#000664; RRID:IMSR_JAX:000664
Article Title: Glycolysis inhibition functionally reprograms T follicular helper cells and reverses lupus.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cyto-ID Autophagy Detection Kit Enzo Life Sci Cat#ENZ-51031-K200 RosetteSep CD4 + T cell enrichment cocktail Stemcell Tech. .. Cat#15062 NAD/NADH-Glo TM kit Promega Cat#G9071 RNeasy Plus Micro Kit Qiagen Cat#74034 TruSeq Stranded RNA Sample Preparation Kit Illumina Cat#20020596 AMPure XP beads Beckman Coulter Cat#A63880 Quant-iT TM PicoGreen TM dsDNA assay ThermoFisher Cat#P7589 Qick-DNA Microprep Plus kit Zymo Research Cat#D4074 Next Enzymatic Methyl-seq Kit NEB Cat#E7120 Fixation/Permeabilization kit eBioscience Cat#00-5123-43 CD4 T cell Isolation Kit Miltenyi Biotec Cat#130-104-454 B Cell Isolation Kit Miltenyi Biotec Cat#130-090-862 Pierce BCA protein assay kit ThermoFisher Cat23225 4 - 20% SDS-PAGE gels BioRad Cat#4561094 Kallestad HEp-2 BioRad Cat#26101 Deposited data Murine Tfh cell RNASeq dataset and DNA bisulfite sequencing dataset NCBI BioProject PRJNA1089578 human Tfh cell RNASeq dataset NCBI BioProject PRJNA1089580 Untargeted metabolomics analysis of murine Tfh cells National Metabolomics Data Repository ST004242 Untargeted metabolomics analysis of human Tfh cells National Metabolomics Data Repository ST004243 Experimental models: Organisms/strains B6.NZM-Sle1 NZM2410/Aeg Sle2 NZM2410/Aeg Sle3 NZM2410/Aeg /LmoJ (TC) female mice Jackson Laboratory RRID:IMSR_JAX:007228 C57BL6/J mice Jackson Laboratory RRID:IMSR_JAX:000664 NZW/J female mice Jackson Laboratory RRID:IMSR_JAX:001058 BXSB/MpJ male mice Jackson Laboratory RRID:IMSR_JAX:000740 WYaa male mice This paper B6.Cg-Sle1 NZM2410/Aeg Yaa/DcrJ Jackson Laboratory RRID:IMSR_JAX:021569 Software and algorithms FlowJo V10 Tree Star https://www.flowjo.com/solutions/flowjo/downloads Prism Graphpad https://www.graphpad.com/scientific-software/prism/ ImageJ NIH https://imagej.nih.gov/ij/ Metamorph Molecular Devices https://www.moleculardevices.com/products/ cellular-imaging-systems/high-contentanalysis/metamorph-microscopy STAR aligner v2.7 Open source https://github.com/alexdobin/STAR FeatureCounts (v2.0) Bioconductor https://subread.sourceforge.net/featureCounts.html DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html pheatmap R function (version 1.0.12) Datacamp https://www.rdocumentation.org/packages/ pheatmap/versions/1.0.12 Matplotlib-Venn (Version 0.11.5) MIT https://www.piwheels.org/project/matplotlib-venn/ Bismark v0.22.3 Babraham Institute https://www.bioinformatics.babraham.ac.uk/ projects/bismark/ DSS Ge et al. 84 https://www.bioconductor.org/packages/ release/bioc/html/DSS.html BEDTools v2.29.2 Ge et al. 84 https://bedtools.readthedocs.io/en/latest/ DAVID NCI https://david.ncifcrf.gov 20 Cell Reports 44, 116600, December 23, 2025 ..
Article Title: GPR75 in glutamatergic neurons regulates body weight.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Gpr75 Novus Biologicals Cat# NBP1-59406; RRID: AB_11037221 Opal570 Akoya Biosciences Cat# FP1488001KT; RRID: AB_3739820 Opal520 Akoya Biosciences Cat# FP1487001KT; RRID: AB_3739821 Chemicals, peptides, and recombinant proteins Alt-R TM S.p. dCas9 Protein V3 Integrated DNA Technologies Cat#1081067 Gpr75 (NINQMPIPSA(R10), AQUA QuantProHeavy ThermoFisher N/A Critical commercial assays Multiplex fluorescent kit Bio-techne Cat# 323110 Aurum TM Total RNA Fatty and Fibrous Tissue Kit Biorad Cat# 7326830 High-Capacity cDNA Synthesis Kit Applied Biosystems Cat# 43-688-14 BCA protein assay kit ThermoFisher Cat# A55864 protein A/G beads ThermoFisher Cat# 88803 Deposited data Adulescent Mouse Brain Atlas Zeisel et al. 29 http://mousebrain.org Mendeley data (raw data) This manuscript Mendeley Data: http://doi.org/10.17632/ 789hrg254v.1 Experimental models: Organisms/strains vGlut2-Cre (Slc17a6 tm2(cre)Lowl ) Vong et al. 32 Bradford Lowell vGat-Cre (B6J.129S6(FVB)-Slc32a1 tm2(cre)Lowl /MwarJ) Vong et al. 32 Bradford Lowell Cmv-Cre (B6.C-Tg(CMV-cre)1Cgn/J) Jackson Labs RRID:IMSR_JAX:006054 Gpr75 flox This manuscript N/A Gpr75 TB This manuscript N/A Oligonucleotides 5 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA CAGGAAUACGACCUCUCCAUGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A 3 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA UAGAGGAUUGUACUACAGUAGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Gpr75 TB floxed Alt-R CRISPR-Cas9 gRNA CAUUGGGGACAUUCUGAAGCGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Alt-R TM CRISPR-Cas9 tracrRNA Integrated DNA Technologies (IDT) Cat# 1072532 qPCR probes: Table S1 Life Biotechnologies N/A Genotyping primers: Table S1 Integrated DNA Technologies (IDT) N/A RNAscope Probe Gpr75 Bio-techne cat# 318281-c1 RNAscope Probe Slc17a6 Bio-techne cat#319171-c2 RNAscope Probe Gad1 Bio-techne cat#400951-C2 Software and algorithms ImageJ Schneider et al. 71 https://imagej.nih.gov/ij/ CFX maestro Software v2.3 Biorad #12013758 DIA-NN v1.8.1 Demichev et al. 72 https://aptila.bio Prism (version 10.4.0) GraphPad www.graphpad.com Other High Fat Diet Research Diets Inc D12492 12 Cell Reports 45, 117011, March 24, 2026 ..
Article Title: Intra-tumoral hypoxia promotes CD8 + T cell dysfunction via chronic activation of integrated stress response transcription factor ATF4.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Human pleomorphic undifferentiated high-grade deep sarcomas University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Human blood (matched to tumor) University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Chemical, peptide and recombinant proteins Recombinant human IL-2 NCI: Biological Resources Branch Ro 23-6019 GolgiPlug Protein Transport Inhibitor (Brefeldin A) BD Biosciences Cat# 51-2301KZ Cell Stimulation Cocktail ThermoFisher Cat# 00-4970-93 Pierce RIPA Buffer Thermo Scientific Cat# 89900 Protease Inhibitor Cocktail Cell Signaling Technology Cat# 5871 Phosphatase Inhibitor Cocktail I Sigma Aldrich Cat# P2850 Phosphatase Inhibitor Cocktail II Sigma Aldrich Cat# P5726 OVA peptide (OVA 257-267) InvivoGen Cat# vac-sin Geneticin Selective Antibiotic ThermoFisher Cat# 10131-035 Seahorse XF DMEM Medium, pH 7.4 Agilent Cat# 103575-100 CellTak Cell and Tissue Adhesive Corning Cat# 354240 Histopaque-1077 Sigma Aldrich Cat# 10771 N-acetyl-L-cysteine Sigma Aldrich Cat# A9165 Percoll Cytiva Cat# 17089101 Critical commercial assays UltraComp eBeads Plus Compensation Beads ThermoFisher Cat# 1333342 Foxp3/Transcription Factor Fixation/ Permeabilization Kit ThermoFisher Cat# 00-5521-00 Pierce BCA Protein Assay Kit ThermoFisher Cat# 23225 Seahorse XFe96 FluxPak Mini Agilent Technologies Cat# 102601-100 Zombie NIR Viability Stain Biolegend Cat# 420106 MitoSox Mitochondrial Superoxide Indicator ThermoFisher Cat# M36008 RNeasy RNA Isolation Kit Qiagen Cat# 74104 High Capacity RNA-to-cDNA Kit ThermoFisher Cat# 4387406 Taqman single gene expression qPCR Mastermix ThermoFisher Cat# 4440040 Mouse Tumor Dissociation Kit Miltenyi Biotec Cat# 130-096-730 Human Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 EasySep Mouse CD8 + T Cell Isolation Kit Stemcell Technologies Cat# 19853 P3 Primary Cell 4D Nucleofector X Kit S Lonza Cat# V4XP-3032 Alt-R Sp Cas9 Nuclease V3 IDT Cat# 1081059 ISRIB Sigma Aldrich Cat# SML0843 eBioscience Annexin V-FITC Apoptosis Detection Kit ThermoFisher Cat# 88-8103-72 eBioscience BrdU Staining Kit for Flow Cytometry APC ThermoFisher Cat# 8817-6600-42 GSK2606414 (PERKi) Selleckchem Cat# S7307 GCN2iB Selleckchem Cat# S8929 PKR-IN-C16 Selleckchem Cat# S9668 Mouse T cell Activator CD3/CD28 Dynabeads ThermoFisher Cat# 11452D Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat# RPN2232 OPAL 6-plex detection kit Akoya Cat# NEL8710011KT Bond dewax solution Leica Cat# AR9222 (Continued on next page) e2 Immunity 58, 1–16.e1–e8, October 14, 2025 .. E8Icre (C57BL/6-Tg(Cd8a-cre)1Itan/J), ATF4 Tg/Tg (C57BL/6;129X1-Gt(ROSA)26Sor tm2(ATF4)Myz /J), ATF4 f/f (C57BL/6-Atf4 tm1.1Cmad /J), OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J), CD45.1 (C57BL/6.SJL-Ptprc a Pepc b /BoyJ), and C57BL/6 mice were obtained from Jackson Laboratories.
Sequencing:Article Title: Commensal enteric virome regulates intestinal carbohydrate digestion and absorption.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LB Broth hopebio Cat#HB0128 Nutrient Broth hopebio Cat#HB0108 Collagenase type 3 Worthington Cat#LS004182 Percoll Sigma Cat#P7828 Clodronate liposomes Yeasen Cat#40337ES08 Trizol ThermoFisher Cat#15596018CN DNase Sigma Cat#DN-25 Phenol/Chloroform/Isoamyl alcohol (25:24:1) Sigma Cat#P3803 Phusion DNA polymerase New England Biolabs Cat#M0530S 5(6)-Carboxyfluorescein N-hydroxysuccinimide ester Aladdin Cat#C107884 Lipofectamine 2000 ThermoFisher Cat#11668030 Critical commercial assays Periodic Acid-Schiff Staining Kit Beyotime Cat#C0142S Pan T Cell Isolation Kit II, mouse Miltenyi Biotec Cat#130-095-130 Anti-F4/80 MicroBeads UltraPure, mouse Miltenyi Biotec Cat#130-110-443 EasySep Mouse Pan-ILC Enrichment Kit STEMCELL Technologies Cat#19875 Mouse IL-22 High Sensitivity ELISA Kit Multi sciences Cat#EK222HS Mouse IL-23 ELISA Kit Multi sciences Cat#EK223 Mouse Insulin ELISA Kit MEIMIAN Cat#MM-0579M2 Mouse IL-6 ELISA Kit RUISAIQI Cat#R-S-M0007 Mouse IL-1β ELISA Kit RUISAIQI Cat#R-S-M0003 Mouse TNF-α ELISA Kit RUISAIQI Cat#R-S-M0002 Mouse Adiponectin ELISA Kit RUISAIQI Cat#R-S-M10108 Evo M-MLV RT Kit with gDNA Clean for qPCR Accurate biology Cat#AG11728 TB Green Premix Ex Taq II (Tli RNase H Plus) Takara Cat#RR820Q E.Z.N.A. .. DNA Kit Omega Bio-tek Cat#D3892-01 TruSeq Nano DNA sample preparation Kit Illumina Cat#15041877 QIAamp MinElute Virus Spin Kit Qiagen Cat#57704 QIAquick Gel Extraction Kit Qiagen Cat#28706 TruSeq RNA Library Prep Kit Illumina Cat#RS-122-2001 Ribo-Zero rRNA Removal Kit Epicenter Cat15066012 BCA Protein Assay Kit ThermoFisher Cat#223250 quick-dna fecal/soil microbe miniprep kit Zymo research Cat#D6010S Deposited data Enteric virome and bacteriome sequencing, and mouse small intestinal scRNA-seq and bulk RNA sequencing This study PRJCA029200 https://ngdc.cncb.ac.cn/gsa/ Experimental models: Cell lines Caco-2 ATCC Cat#HTB-37 Experimental models: Organisms/strains BALB/cNj-Foxn1nu/Gpt GemPharmatech D000521 RRID:IMSR_GPT:D000521 C57BL/6JGpt GemPharmatech N000013 RRID:IMSR_GPT:N000013 BALB/cJGpt GemPharmatech N000020 RRID:IMSR_GPT:N000020 C57BL/6JGpt-Rag2em6Cd6972/Gpt GemPharmatech T011534 RRID:IMSR_GPT:T011534 C57BL/6JGpt-Il22em4Cd16159/Gpt GemPharmatech T052618 RRID:IMSR_GPT:T052618 C57BL/6Smoc-Cd74em1Smoc Shanghai Model Organisms NM-KO-190772 RRID: IMSR_NM-KO-190772 Oligonucleotides Primers for qPCR, see Table S3 Sangon Biotech N/A (Continued on next page) e2 Cell Host & Microbe 34, 1–16.e1–e8, March 11, 2026 ..
RNA Sequencing:Article Title: Commensal enteric virome regulates intestinal carbohydrate digestion and absorption.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LB Broth hopebio Cat#HB0128 Nutrient Broth hopebio Cat#HB0108 Collagenase type 3 Worthington Cat#LS004182 Percoll Sigma Cat#P7828 Clodronate liposomes Yeasen Cat#40337ES08 Trizol ThermoFisher Cat#15596018CN DNase Sigma Cat#DN-25 Phenol/Chloroform/Isoamyl alcohol (25:24:1) Sigma Cat#P3803 Phusion DNA polymerase New England Biolabs Cat#M0530S 5(6)-Carboxyfluorescein N-hydroxysuccinimide ester Aladdin Cat#C107884 Lipofectamine 2000 ThermoFisher Cat#11668030 Critical commercial assays Periodic Acid-Schiff Staining Kit Beyotime Cat#C0142S Pan T Cell Isolation Kit II, mouse Miltenyi Biotec Cat#130-095-130 Anti-F4/80 MicroBeads UltraPure, mouse Miltenyi Biotec Cat#130-110-443 EasySep Mouse Pan-ILC Enrichment Kit STEMCELL Technologies Cat#19875 Mouse IL-22 High Sensitivity ELISA Kit Multi sciences Cat#EK222HS Mouse IL-23 ELISA Kit Multi sciences Cat#EK223 Mouse Insulin ELISA Kit MEIMIAN Cat#MM-0579M2 Mouse IL-6 ELISA Kit RUISAIQI Cat#R-S-M0007 Mouse IL-1β ELISA Kit RUISAIQI Cat#R-S-M0003 Mouse TNF-α ELISA Kit RUISAIQI Cat#R-S-M0002 Mouse Adiponectin ELISA Kit RUISAIQI Cat#R-S-M10108 Evo M-MLV RT Kit with gDNA Clean for qPCR Accurate biology Cat#AG11728 TB Green Premix Ex Taq II (Tli RNase H Plus) Takara Cat#RR820Q E.Z.N.A. .. DNA Kit Omega Bio-tek Cat#D3892-01 TruSeq Nano DNA sample preparation Kit Illumina Cat#15041877 QIAamp MinElute Virus Spin Kit Qiagen Cat#57704 QIAquick Gel Extraction Kit Qiagen Cat#28706 TruSeq RNA Library Prep Kit Illumina Cat#RS-122-2001 Ribo-Zero rRNA Removal Kit Epicenter Cat15066012 BCA Protein Assay Kit ThermoFisher Cat#223250 quick-dna fecal/soil microbe miniprep kit Zymo research Cat#D6010S Deposited data Enteric virome and bacteriome sequencing, and mouse small intestinal scRNA-seq and bulk RNA sequencing This study PRJCA029200 https://ngdc.cncb.ac.cn/gsa/ Experimental models: Cell lines Caco-2 ATCC Cat#HTB-37 Experimental models: Organisms/strains BALB/cNj-Foxn1nu/Gpt GemPharmatech D000521 RRID:IMSR_GPT:D000521 C57BL/6JGpt GemPharmatech N000013 RRID:IMSR_GPT:N000013 BALB/cJGpt GemPharmatech N000020 RRID:IMSR_GPT:N000020 C57BL/6JGpt-Rag2em6Cd6972/Gpt GemPharmatech T011534 RRID:IMSR_GPT:T011534 C57BL/6JGpt-Il22em4Cd16159/Gpt GemPharmatech T052618 RRID:IMSR_GPT:T052618 C57BL/6Smoc-Cd74em1Smoc Shanghai Model Organisms NM-KO-190772 RRID: IMSR_NM-KO-190772 Oligonucleotides Primers for qPCR, see Table S3 Sangon Biotech N/A (Continued on next page) e2 Cell Host & Microbe 34, 1–16.e1–e8, March 11, 2026 ..
Article Title: Activation-induced SLC7A1 expression enhances T cell sensitivity to cGAMP-mediated STING signaling.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Poly-D-lysine Gibco/ThermoFisher Cat#A3890401 DMEM Corning Cat#10-013-CV RPMI 1640 Corning Cat#10-040-CV IMDM Corning Cat#10-016-CV RPMI 1640 for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88365 IMDM for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88423 Vascular Cell Basal Medium ATCC Cat#PCS-100-030 Microvascular Endothelial Cell Growth Kit-VEGF ATCC Cat#PCS-110-041 Fetal bovine serum (FBS) Atlanta Biologicals Cat#S11150 Penicillin-Streptomycin (10,000 U/mL) Gibco/ThermoFisher Cat#15140122 1× RBC Lysis Buffer Invitrogen/ThermoFisher Cat#00-4333-57 FuGENE 6 transfection reagent Promega Cat#E2691 Dynabeads Human T-Activator CD3/CD28 ThermoFisher Cat#11131D Dynabeads Mouse T-Activator CD3/CD28 ThermoFisher Cat#11452D Recombinant human IL-2 PeproTech Cat#200-02 UltraComp eBeads Plus Compensation Beads ThermoFisher Cat#01-3333-41 T-PER Tissue Protein Extraction Reagent ThermoFisher Cat#78510 TRIzol Reagent ThermoFisher Cat#15596026 Laemmli Sample Buffer (4×) Bio-Rad Cat#1610747 L-[2,3,4-3H]-Arginine monohydrochloride PerkinElmer/Revvity Cat#NET1123250UC Alt-R S.p. .. Cas9 Nuclease V3 Integrated DNA Technologies Cat#1081058 P3 Primary Cell 4D-Nucleofector X Kit Lonza Cat#V4XP-3024 eBioscience Fixable Viability Dye eFluor 780 ThermoFisher Cat#65-0865-14 DAPI ThermoFisher Cat#D1306 7-AAD ThermoFisher Cat#A1310 SurePAGETM, Bis-Tris, 10 × 8, 4-12%, 15 wells GenScript Cat#M00654 Critical commercial assays CellTiter-Glo 2.0 Cell Viability Assay Promega Cat#G9241 2′3′-cGAMP ELISA kit Cayman Chemical Cat#501700 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 RosetteSep Human T cell Enrichment Cocktail StemCell Technologies Cat#15061 SepMate-50 PBMC isolation tubes StemCell Technologies Cat#85450 MojoSort Mouse CD4 T cell Isolation Kit BioLegend Cat#480033 MojoSort Mouse CD8 T cell Isolation Kit BioLegend Cat#480035 Direct-zol RNA MiniPrep Kit Zymo Research Cat#R2050 Maxima First Strand cDNA Synthesis Kit for RTqPCR ThermoFisher Cat#K1672 AccuPower GreenStar RT-qPCR Master Mix Bioneer Cat#K-6403 Gibson Assembly HiFi DNA Master Mix New England Biolabs Cat#E2621 QIAamp DNA Blood Maxi Kit QIAGEN Cat#51194 NextSeq 500/550 Mid Output v2 kit Illumina Cat#FC-404-2001 Deposited data Uncropped Western blot images This paper Mendeley Data: https://doi.org/10.17632/ trrgvjfbx3.2 Bulk RNA-seq: resting vs. activated human T cells This paper GEO: GSE325689 Bulk RNA-seq: SLC7A1- and SLC7A2overexpressing U937 SLC19A1− /− cells This paper GEO: GSE325690 sgRNA counts from CRISPR live/dead screen This paper Table S2 (Continued on next page) Cell Reports 45, 117580, July 28, 2026 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human immune cell transcript database (DICE) Schmiedel et al.33 https://dice-database.org/ Human T cell proteomic database Cano-Gamez et al.39 https://cytokines.cellgeni.sanger.ac.uk/ Human Protein Atlas v25.0 Jin et al.40 https://proteinatlas.org AlphaFold structure of human SLC7A1 Jumper et al.41 UniProt: P30825 AlphaFold structure of human SLC7A2 Jumper et al.41 UniProt: P52569 Geobacillus LAT crystal structure (arginine-bound) Jungnickel et al.37 PDB: 6F34 Experimental models: Cell lines Human: U937 SLC19A1− /− Ritchie et al.31 N/A Human: HEK293T ATCC Cat#CRL-3216; RRID:CVCL_0063 Human: Jurkat E6-1 ATCC Cat#TIB-152; RRID:CVCL_0367 Human: TIME (telomerase-immortalized microvascular endothelial) ATCC Cat#CRL-4025; RRID:CVCL_0047 Human: OCI-Ly7 DSMZ Cat#ACC688 Mouse: BV-2 Accegen Cat#ABC-TC212S Experimental models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory Strain#000664; RRID:IMSR_JAX:000664
Real-time Polymerase Chain Reaction:Article Title: Commensal enteric virome regulates intestinal carbohydrate digestion and absorption.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LB Broth hopebio Cat#HB0128 Nutrient Broth hopebio Cat#HB0108 Collagenase type 3 Worthington Cat#LS004182 Percoll Sigma Cat#P7828 Clodronate liposomes Yeasen Cat#40337ES08 Trizol ThermoFisher Cat#15596018CN DNase Sigma Cat#DN-25 Phenol/Chloroform/Isoamyl alcohol (25:24:1) Sigma Cat#P3803 Phusion DNA polymerase New England Biolabs Cat#M0530S 5(6)-Carboxyfluorescein N-hydroxysuccinimide ester Aladdin Cat#C107884 Lipofectamine 2000 ThermoFisher Cat#11668030 Critical commercial assays Periodic Acid-Schiff Staining Kit Beyotime Cat#C0142S Pan T Cell Isolation Kit II, mouse Miltenyi Biotec Cat#130-095-130 Anti-F4/80 MicroBeads UltraPure, mouse Miltenyi Biotec Cat#130-110-443 EasySep Mouse Pan-ILC Enrichment Kit STEMCELL Technologies Cat#19875 Mouse IL-22 High Sensitivity ELISA Kit Multi sciences Cat#EK222HS Mouse IL-23 ELISA Kit Multi sciences Cat#EK223 Mouse Insulin ELISA Kit MEIMIAN Cat#MM-0579M2 Mouse IL-6 ELISA Kit RUISAIQI Cat#R-S-M0007 Mouse IL-1β ELISA Kit RUISAIQI Cat#R-S-M0003 Mouse TNF-α ELISA Kit RUISAIQI Cat#R-S-M0002 Mouse Adiponectin ELISA Kit RUISAIQI Cat#R-S-M10108 Evo M-MLV RT Kit with gDNA Clean for qPCR Accurate biology Cat#AG11728 TB Green Premix Ex Taq II (Tli RNase H Plus) Takara Cat#RR820Q E.Z.N.A. .. DNA Kit Omega Bio-tek Cat#D3892-01 TruSeq Nano DNA sample preparation Kit Illumina Cat#15041877 QIAamp MinElute Virus Spin Kit Qiagen Cat#57704 QIAquick Gel Extraction Kit Qiagen Cat#28706 TruSeq RNA Library Prep Kit Illumina Cat#RS-122-2001 Ribo-Zero rRNA Removal Kit Epicenter Cat15066012 BCA Protein Assay Kit ThermoFisher Cat#223250 quick-dna fecal/soil microbe miniprep kit Zymo research Cat#D6010S Deposited data Enteric virome and bacteriome sequencing, and mouse small intestinal scRNA-seq and bulk RNA sequencing This study PRJCA029200 https://ngdc.cncb.ac.cn/gsa/ Experimental models: Cell lines Caco-2 ATCC Cat#HTB-37 Experimental models: Organisms/strains BALB/cNj-Foxn1nu/Gpt GemPharmatech D000521 RRID:IMSR_GPT:D000521 C57BL/6JGpt GemPharmatech N000013 RRID:IMSR_GPT:N000013 BALB/cJGpt GemPharmatech N000020 RRID:IMSR_GPT:N000020 C57BL/6JGpt-Rag2em6Cd6972/Gpt GemPharmatech T011534 RRID:IMSR_GPT:T011534 C57BL/6JGpt-Il22em4Cd16159/Gpt GemPharmatech T052618 RRID:IMSR_GPT:T052618 C57BL/6Smoc-Cd74em1Smoc Shanghai Model Organisms NM-KO-190772 RRID: IMSR_NM-KO-190772 Oligonucleotides Primers for qPCR, see Table S3 Sangon Biotech N/A (Continued on next page) e2 Cell Host & Microbe 34, 1–16.e1–e8, March 11, 2026 ..
Article Title: GPR75 in glutamatergic neurons regulates body weight.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Gpr75 Novus Biologicals Cat# NBP1-59406; RRID: AB_11037221 Opal570 Akoya Biosciences Cat# FP1488001KT; RRID: AB_3739820 Opal520 Akoya Biosciences Cat# FP1487001KT; RRID: AB_3739821 Chemicals, peptides, and recombinant proteins Alt-R TM S.p. dCas9 Protein V3 Integrated DNA Technologies Cat#1081067 Gpr75 (NINQMPIPSA(R10), AQUA QuantProHeavy ThermoFisher N/A Critical commercial assays Multiplex fluorescent kit Bio-techne Cat# 323110 Aurum TM Total RNA Fatty and Fibrous Tissue Kit Biorad Cat# 7326830 High-Capacity cDNA Synthesis Kit Applied Biosystems Cat# 43-688-14 BCA protein assay kit ThermoFisher Cat# A55864 protein A/G beads ThermoFisher Cat# 88803 Deposited data Adulescent Mouse Brain Atlas Zeisel et al. 29 http://mousebrain.org Mendeley data (raw data) This manuscript Mendeley Data: http://doi.org/10.17632/ 789hrg254v.1 Experimental models: Organisms/strains vGlut2-Cre (Slc17a6 tm2(cre)Lowl ) Vong et al. 32 Bradford Lowell vGat-Cre (B6J.129S6(FVB)-Slc32a1 tm2(cre)Lowl /MwarJ) Vong et al. 32 Bradford Lowell Cmv-Cre (B6.C-Tg(CMV-cre)1Cgn/J) Jackson Labs RRID:IMSR_JAX:006054 Gpr75 flox This manuscript N/A Gpr75 TB This manuscript N/A Oligonucleotides 5 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA CAGGAAUACGACCUCUCCAUGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A 3 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA UAGAGGAUUGUACUACAGUAGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Gpr75 TB floxed Alt-R CRISPR-Cas9 gRNA CAUUGGGGACAUUCUGAAGCGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Alt-R TM CRISPR-Cas9 tracrRNA Integrated DNA Technologies (IDT) Cat# 1072532 qPCR probes: Table S1 Life Biotechnologies N/A Genotyping primers: Table S1 Integrated DNA Technologies (IDT) N/A RNAscope Probe Gpr75 Bio-techne cat# 318281-c1 RNAscope Probe Slc17a6 Bio-techne cat#319171-c2 RNAscope Probe Gad1 Bio-techne cat#400951-C2 Software and algorithms ImageJ Schneider et al. 71 https://imagej.nih.gov/ij/ CFX maestro Software v2.3 Biorad #12013758 DIA-NN v1.8.1 Demichev et al. 72 https://aptila.bio Prism (version 10.4.0) GraphPad www.graphpad.com Other High Fat Diet Research Diets Inc D12492 12 Cell Reports 45, 117011, March 24, 2026 ..
Article Title: Intra-tumoral hypoxia promotes CD8 + T cell dysfunction via chronic activation of integrated stress response transcription factor ATF4.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Human pleomorphic undifferentiated high-grade deep sarcomas University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Human blood (matched to tumor) University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Chemical, peptide and recombinant proteins Recombinant human IL-2 NCI: Biological Resources Branch Ro 23-6019 GolgiPlug Protein Transport Inhibitor (Brefeldin A) BD Biosciences Cat# 51-2301KZ Cell Stimulation Cocktail ThermoFisher Cat# 00-4970-93 Pierce RIPA Buffer Thermo Scientific Cat# 89900 Protease Inhibitor Cocktail Cell Signaling Technology Cat# 5871 Phosphatase Inhibitor Cocktail I Sigma Aldrich Cat# P2850 Phosphatase Inhibitor Cocktail II Sigma Aldrich Cat# P5726 OVA peptide (OVA 257-267) InvivoGen Cat# vac-sin Geneticin Selective Antibiotic ThermoFisher Cat# 10131-035 Seahorse XF DMEM Medium, pH 7.4 Agilent Cat# 103575-100 CellTak Cell and Tissue Adhesive Corning Cat# 354240 Histopaque-1077 Sigma Aldrich Cat# 10771 N-acetyl-L-cysteine Sigma Aldrich Cat# A9165 Percoll Cytiva Cat# 17089101 Critical commercial assays UltraComp eBeads Plus Compensation Beads ThermoFisher Cat# 1333342 Foxp3/Transcription Factor Fixation/ Permeabilization Kit ThermoFisher Cat# 00-5521-00 Pierce BCA Protein Assay Kit ThermoFisher Cat# 23225 Seahorse XFe96 FluxPak Mini Agilent Technologies Cat# 102601-100 Zombie NIR Viability Stain Biolegend Cat# 420106 MitoSox Mitochondrial Superoxide Indicator ThermoFisher Cat# M36008 RNeasy RNA Isolation Kit Qiagen Cat# 74104 High Capacity RNA-to-cDNA Kit ThermoFisher Cat# 4387406 Taqman single gene expression qPCR Mastermix ThermoFisher Cat# 4440040 Mouse Tumor Dissociation Kit Miltenyi Biotec Cat# 130-096-730 Human Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 EasySep Mouse CD8 + T Cell Isolation Kit Stemcell Technologies Cat# 19853 P3 Primary Cell 4D Nucleofector X Kit S Lonza Cat# V4XP-3032 Alt-R Sp Cas9 Nuclease V3 IDT Cat# 1081059 ISRIB Sigma Aldrich Cat# SML0843 eBioscience Annexin V-FITC Apoptosis Detection Kit ThermoFisher Cat# 88-8103-72 eBioscience BrdU Staining Kit for Flow Cytometry APC ThermoFisher Cat# 8817-6600-42 GSK2606414 (PERKi) Selleckchem Cat# S7307 GCN2iB Selleckchem Cat# S8929 PKR-IN-C16 Selleckchem Cat# S9668 Mouse T cell Activator CD3/CD28 Dynabeads ThermoFisher Cat# 11452D Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat# RPN2232 OPAL 6-plex detection kit Akoya Cat# NEL8710011KT Bond dewax solution Leica Cat# AR9222 (Continued on next page) e2 Immunity 58, 1–16.e1–e8, October 14, 2025 .. E8Icre (C57BL/6-Tg(Cd8a-cre)1Itan/J), ATF4 Tg/Tg (C57BL/6;129X1-Gt(ROSA)26Sor tm2(ATF4)Myz /J), ATF4 f/f (C57BL/6-Atf4 tm1.1Cmad /J), OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J), CD45.1 (C57BL/6.SJL-Ptprc a Pepc b /BoyJ), and C57BL/6 mice were obtained from Jackson Laboratories.
Recombinant:Article Title: Cereblon-based KRAS degrading PROTACs and uses related thereto
Article Snippet: Densitometry analysis was done using ImageJ software, all samples were normalized to vinculin loading control and then graphed as a percent of control as compared to vehicle treated tumors. .. Reagents for Cell Culture/Implantation DMEM—Gibco/ThermoFisher #10566016 RPMI-1640—Gibco/ThermoFisher #61870036 DMEM/F12—Gibco/ThermoFisher #10565018 DMEM (phenol red-free)—Gibco/ThermoFisher #21063029 RPMI-1640 (phenol red-free) Gibco/ThermoFisher #11835030 DPBS—Gibco/ThermoFisher #14190144 Trypsin/EDTA—Gibco/ThermoFisher #25200056 FBS—Gibco/ThermoFisher #26140079 Penicillin-Streptomycin (PenStrep)—Gibco/ThermoFisher #15140122 Human EGF recombinant protein—Gibco/ThermoFisher #PHG0315 EMEM—ATCC #302003 RPMI-1640—ATCC #302001 Hydrocortisone—Millipore Sigma #H0135-1 mg Insulin solution, human—Millipore Sigma #19278-5 ml ITS supplement—R&D Systems #AR013 Matrigel—Corning #354234 HYPER flask—Corning #10034 Reagents for Tumor Western Blots RIPA buffer—ThermoFisher #89900 HALT protease inhibitor—ThermoFisher #78437 HALT phosphatase inhibitor—Thermofisher #78420 EDTA, 0.5M—Thermofisher #1861275 BCA Protein Assay kit—ThermoFisher #23225 NuPAGE 4×LDS sample buffer—ThermoFisher #NP0007 Bolt 10×sample reducing agent—Thermofisher #B0009 NuPAGE 4-12% Bis-Tris Midi gel, 26 well—ThermoFisher #WG1403BX10 BioRad Precision Plus Dual Color ladder—BioRad #1610374 Trans-blot midi Nitrocellulose transfer pack—Biorad #1704159 MOPS/SDS running buffer—Thermofisher #NP0001-02 SuperSignalTM West Femto—ThermoFisher #34095 TBS-T (1×TBS with 0.1% tween-20) BSA, bovine serum albumin, fraction V—AmericanBio #AB00440-01000 5 mm stainless steel bead—Qiagen #69989 Ras (G12D mutant specific)(D8H7) Rabbit mAb—Cell Signaling Technology #14429S Vinculin (E1E9V) XP Rabbit mAb—Cell Signaling Technology #13901S Anti-rabbit IgG, HRP-linked Antibody—Cell Signaling Technology #7074P2 The disclosed subject matter is not to be limited in scope by the specific embodiments and examples described herein. ..
Article Title: Coxsackievirus B infection invokes unique cell-type-specific responses in primary human pancreatic islets.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TotalSeq TM -A0251 anti-human Hashtag 1 Antibody BioLegend 394601; RRID: AB_2750015 TotalSeq TM -A0252 anti-human Hashtag 2 Antibody BioLegend 394603; RRID: AB_2750016 TotalSeq TM -A0253 anti-human Hashtag 3 Antibody BioLegend 394605; RRID: AB_2750017 TotalSeq TM -A0254 anti-human Hashtag 4 Antibody BioLegend 394607; RRID: AB_2750018 TotalSeq TM -A0255 anti-human Hashtag 5 Antibody BioLegend 394609; RRID: AB_2750019 TotalSeq TM -A0256 anti-human Hashtag 6 Antibody BioLegend 394611; RRID: AB_2750020 LC3B Antibody Cell Signaling Cat#2775S; RRID: AB_915950 Anti-SQSTM1/P62 Antibody [2C11] Abcam Cat#Ab56416; RRID: AB_945626 GAPDH (14C10 Rabbit mAb Cell Signaling Cat#2118S; RRID: AB_561053 HRP-linked anti-mouse igG antibody Cell Signaling Cat#7076S; RRID: AB_330924 HRP-linked anti-rabbit igG antibody Cell Signaling Cat#7074S; RRID: AB_2099233 Bacterial and virus strains CVB3-EGFP Hubert Tse N/A One Shot TM Stb13 TM Chemically Competent cells Invitrogen Cat#C737303 Biological samples Healthy primary human islets Prodo Laboratories Inc. N/A Chemicals, peptides, and recombinant proteins CMRL 1066 Corning Cat#99-603-CV mTeSR1 Stem Cell Technologies Cat#05850 TrypLE Express Life Technologies Cat#12604039 Y-27632 Pepro Tech Cat#129382310MG hESC-qualified Corning Matrigel Matrix Corning Cat#354277 Polyinosinic-polycytidylic acid [poly(I:C)] InvivoGen Cat#tlrl-piclv 1X PBS Corning Cat#21-030-CV DNase Qiagen Cat#79254 PowerUP SYBR Green Master Mix Life Technologies Cat#A25742 XF calibrant solution Agilent Cat#100840-000 Seahorse XF RPMI Agilent Cat#103576-100 Oligomycin Sigma Cat#O4876 FCCP & rotenone Sigma Cat#R8875 Antimycin A Sigma Cat#A8674 Heat-inactivated FBS MilliporeSigma Cat#F4135 Sodium pyruvate Corning Cat#25-000-CL Polyethylenimine Max Polysciences Cat#24765-2 Lenti-X concentrator Takara Cat#631232 Lenti-X GoStix Plus Takara Cat#631280 Lysis Buffer Cell Signaling Cat#9803 Protease inhibitor Sigma Cat#118336170001 4-12% Bolt Bis-Tris Plus Mini Protein Gel ThermoFisher Cat#NW04120BOX; Cat#NW04122BOX PVDF membrane Bio-Rad Cat#1620177 Cytiva Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat#RPN2232 Critical commercial assays RNeasy Mini Kit Qiagen Cat#74106 (Continued on next page) 16 Cell Reports 44, 116211, September 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER High-Capacity cDNA Reverse Transcriptase Kit Applied Biosystems Cat#4368813 Chromium Single Cell 3 ′ V3.1 Library and Gel Bead Kit 10X Genomics Cat#PN-1000128 Dihydroethidium assay kit Abcam Cat#ab236206 QIAprep Miniprep kit Qiagen Cat#27115 Qiagen Maxi plus kit Qiagen Cat#12981 CellTiter-Fluor Cell Viability Assay Promega Cat#G6080 Caspase-Glo 3/7 Assay System Promega Cat#G8090 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 Deposited data Raw and processed scRNA-seq and bulkRNA-seq data This Paper GEO: GSE274264 Raw and processed scRNA-seq data – Human Islets Xin et al. 44 GEO: GSE114297 Raw and processed scRNA-seq data- Human Islets Maestas et al. 39 GEO: GSE237448 Experimental models: Cell lines Human: HUES8 hESC HSCI hES Cell Line: HUES-8 Oligonucleotides See Data S1 for primers used in this study This paper N/A Recombinant DNA MIR7-3HG-sh-1 (CCTTCTTCTGCAAGCTCCATT) MilliporeSigma TRCN0000172497 MIR7-3HG-sh-2 (CGAAGTTTGACGGTCTGGAAA) Millipore Sigma TRCN0000173026 pMD2.G Didier Trono Addgene #12259 psPAX2 Didier Trono Addgene #12260 Software and algorithms Seurat V4.3.0.1 Hao et al. 106 https://satijalab.org/seurat/articles/ install_v5 R V4.0.3 R https://cran.rstudio.com/bin/windows/ base/old/4.0.3/ R Studio V1.3.1093 RStudio https://posit.co/download/rstudio- desktop/ Progeny Schubert et al. 45 https://www.bioconductor.org/packages/ release/bioc/html/progeny.html#:∼:text= PROGENy%20is%20resource%20that%20 leverages%20a%20large%20compendium, of%20pathway%20responsive%20genes %20for%20human%20and%20mouse. .. Monocle 3 V1.2.9 Cao et al. 48 https://cole-trapnell-lab.github.io/monocle3/ docs/installation/ Fiji ImageJ ImageJ Public freeware https://fiji.sc/ Other V-bottom 96-well plate Corning Cat#3894 Black, clear bottom 96-well plate Costar Cat#3875 Seahorse XF24 islet Capture Microplates Agilent Cat#101122-100 OCR stats Yé pez et al. 46 https://github.com/vyepez88/OCR- Stats?tab=readme-ov-file Lenti-X 293T cells Takara Cat#632180 White, clear bottom 96-well plate Corning Cat#3903 Cell Reports 44, 116211, September 23, 2025 17
Article Title: GPR75 in glutamatergic neurons regulates body weight.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Gpr75 Novus Biologicals Cat# NBP1-59406; RRID: AB_11037221 Opal570 Akoya Biosciences Cat# FP1488001KT; RRID: AB_3739820 Opal520 Akoya Biosciences Cat# FP1487001KT; RRID: AB_3739821 Chemicals, peptides, and recombinant proteins Alt-R TM S.p. dCas9 Protein V3 Integrated DNA Technologies Cat#1081067 Gpr75 (NINQMPIPSA(R10), AQUA QuantProHeavy ThermoFisher N/A Critical commercial assays Multiplex fluorescent kit Bio-techne Cat# 323110 Aurum TM Total RNA Fatty and Fibrous Tissue Kit Biorad Cat# 7326830 High-Capacity cDNA Synthesis Kit Applied Biosystems Cat# 43-688-14 BCA protein assay kit ThermoFisher Cat# A55864 protein A/G beads ThermoFisher Cat# 88803 Deposited data Adulescent Mouse Brain Atlas Zeisel et al. 29 http://mousebrain.org Mendeley data (raw data) This manuscript Mendeley Data: http://doi.org/10.17632/ 789hrg254v.1 Experimental models: Organisms/strains vGlut2-Cre (Slc17a6 tm2(cre)Lowl ) Vong et al. 32 Bradford Lowell vGat-Cre (B6J.129S6(FVB)-Slc32a1 tm2(cre)Lowl /MwarJ) Vong et al. 32 Bradford Lowell Cmv-Cre (B6.C-Tg(CMV-cre)1Cgn/J) Jackson Labs RRID:IMSR_JAX:006054 Gpr75 flox This manuscript N/A Gpr75 TB This manuscript N/A Oligonucleotides 5 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA CAGGAAUACGACCUCUCCAUGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A 3 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA UAGAGGAUUGUACUACAGUAGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Gpr75 TB floxed Alt-R CRISPR-Cas9 gRNA CAUUGGGGACAUUCUGAAGCGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Alt-R TM CRISPR-Cas9 tracrRNA Integrated DNA Technologies (IDT) Cat# 1072532 qPCR probes: Table S1 Life Biotechnologies N/A Genotyping primers: Table S1 Integrated DNA Technologies (IDT) N/A RNAscope Probe Gpr75 Bio-techne cat# 318281-c1 RNAscope Probe Slc17a6 Bio-techne cat#319171-c2 RNAscope Probe Gad1 Bio-techne cat#400951-C2 Software and algorithms ImageJ Schneider et al. 71 https://imagej.nih.gov/ij/ CFX maestro Software v2.3 Biorad #12013758 DIA-NN v1.8.1 Demichev et al. 72 https://aptila.bio Prism (version 10.4.0) GraphPad www.graphpad.com Other High Fat Diet Research Diets Inc D12492 12 Cell Reports 45, 117011, March 24, 2026 ..
Article Title: Intra-tumoral hypoxia promotes CD8 + T cell dysfunction via chronic activation of integrated stress response transcription factor ATF4.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Human pleomorphic undifferentiated high-grade deep sarcomas University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Human blood (matched to tumor) University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Chemical, peptide and recombinant proteins Recombinant human IL-2 NCI: Biological Resources Branch Ro 23-6019 GolgiPlug Protein Transport Inhibitor (Brefeldin A) BD Biosciences Cat# 51-2301KZ Cell Stimulation Cocktail ThermoFisher Cat# 00-4970-93 Pierce RIPA Buffer Thermo Scientific Cat# 89900 Protease Inhibitor Cocktail Cell Signaling Technology Cat# 5871 Phosphatase Inhibitor Cocktail I Sigma Aldrich Cat# P2850 Phosphatase Inhibitor Cocktail II Sigma Aldrich Cat# P5726 OVA peptide (OVA 257-267) InvivoGen Cat# vac-sin Geneticin Selective Antibiotic ThermoFisher Cat# 10131-035 Seahorse XF DMEM Medium, pH 7.4 Agilent Cat# 103575-100 CellTak Cell and Tissue Adhesive Corning Cat# 354240 Histopaque-1077 Sigma Aldrich Cat# 10771 N-acetyl-L-cysteine Sigma Aldrich Cat# A9165 Percoll Cytiva Cat# 17089101 Critical commercial assays UltraComp eBeads Plus Compensation Beads ThermoFisher Cat# 1333342 Foxp3/Transcription Factor Fixation/ Permeabilization Kit ThermoFisher Cat# 00-5521-00 Pierce BCA Protein Assay Kit ThermoFisher Cat# 23225 Seahorse XFe96 FluxPak Mini Agilent Technologies Cat# 102601-100 Zombie NIR Viability Stain Biolegend Cat# 420106 MitoSox Mitochondrial Superoxide Indicator ThermoFisher Cat# M36008 RNeasy RNA Isolation Kit Qiagen Cat# 74104 High Capacity RNA-to-cDNA Kit ThermoFisher Cat# 4387406 Taqman single gene expression qPCR Mastermix ThermoFisher Cat# 4440040 Mouse Tumor Dissociation Kit Miltenyi Biotec Cat# 130-096-730 Human Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 EasySep Mouse CD8 + T Cell Isolation Kit Stemcell Technologies Cat# 19853 P3 Primary Cell 4D Nucleofector X Kit S Lonza Cat# V4XP-3032 Alt-R Sp Cas9 Nuclease V3 IDT Cat# 1081059 ISRIB Sigma Aldrich Cat# SML0843 eBioscience Annexin V-FITC Apoptosis Detection Kit ThermoFisher Cat# 88-8103-72 eBioscience BrdU Staining Kit for Flow Cytometry APC ThermoFisher Cat# 8817-6600-42 GSK2606414 (PERKi) Selleckchem Cat# S7307 GCN2iB Selleckchem Cat# S8929 PKR-IN-C16 Selleckchem Cat# S9668 Mouse T cell Activator CD3/CD28 Dynabeads ThermoFisher Cat# 11452D Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat# RPN2232 OPAL 6-plex detection kit Akoya Cat# NEL8710011KT Bond dewax solution Leica Cat# AR9222 (Continued on next page) e2 Immunity 58, 1–16.e1–e8, October 14, 2025 .. E8Icre (C57BL/6-Tg(Cd8a-cre)1Itan/J), ATF4 Tg/Tg (C57BL/6;129X1-Gt(ROSA)26Sor tm2(ATF4)Myz /J), ATF4 f/f (C57BL/6-Atf4 tm1.1Cmad /J), OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J), CD45.1 (C57BL/6.SJL-Ptprc a Pepc b /BoyJ), and C57BL/6 mice were obtained from Jackson Laboratories.
Western Blot:Article Title: Cereblon-based KRAS degrading PROTACs and uses related thereto
Article Snippet: Densitometry analysis was done using ImageJ software, all samples were normalized to vinculin loading control and then graphed as a percent of control as compared to vehicle treated tumors. .. Reagents for Cell Culture/Implantation DMEM—Gibco/ThermoFisher #10566016 RPMI-1640—Gibco/ThermoFisher #61870036 DMEM/F12—Gibco/ThermoFisher #10565018 DMEM (phenol red-free)—Gibco/ThermoFisher #21063029 RPMI-1640 (phenol red-free) Gibco/ThermoFisher #11835030 DPBS—Gibco/ThermoFisher #14190144 Trypsin/EDTA—Gibco/ThermoFisher #25200056 FBS—Gibco/ThermoFisher #26140079 Penicillin-Streptomycin (PenStrep)—Gibco/ThermoFisher #15140122 Human EGF recombinant protein—Gibco/ThermoFisher #PHG0315 EMEM—ATCC #302003 RPMI-1640—ATCC #302001 Hydrocortisone—Millipore Sigma #H0135-1 mg Insulin solution, human—Millipore Sigma #19278-5 ml ITS supplement—R&D Systems #AR013 Matrigel—Corning #354234 HYPER flask—Corning #10034 Reagents for Tumor Western Blots RIPA buffer—ThermoFisher #89900 HALT protease inhibitor—ThermoFisher #78437 HALT phosphatase inhibitor—Thermofisher #78420 EDTA, 0.5M—Thermofisher #1861275 BCA Protein Assay kit—ThermoFisher #23225 NuPAGE 4×LDS sample buffer—ThermoFisher #NP0007 Bolt 10×sample reducing agent—Thermofisher #B0009 NuPAGE 4-12% Bis-Tris Midi gel, 26 well—ThermoFisher #WG1403BX10 BioRad Precision Plus Dual Color ladder—BioRad #1610374 Trans-blot midi Nitrocellulose transfer pack—Biorad #1704159 MOPS/SDS running buffer—Thermofisher #NP0001-02 SuperSignalTM West Femto—ThermoFisher #34095 TBS-T (1×TBS with 0.1% tween-20) BSA, bovine serum albumin, fraction V—AmericanBio #AB00440-01000 5 mm stainless steel bead—Qiagen #69989 Ras (G12D mutant specific)(D8H7) Rabbit mAb—Cell Signaling Technology #14429S Vinculin (E1E9V) XP Rabbit mAb—Cell Signaling Technology #13901S Anti-rabbit IgG, HRP-linked Antibody—Cell Signaling Technology #7074P2 The disclosed subject matter is not to be limited in scope by the specific embodiments and examples described herein. ..
Article Title: Activation-induced SLC7A1 expression enhances T cell sensitivity to cGAMP-mediated STING signaling.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Poly-D-lysine Gibco/ThermoFisher Cat#A3890401 DMEM Corning Cat#10-013-CV RPMI 1640 Corning Cat#10-040-CV IMDM Corning Cat#10-016-CV RPMI 1640 for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88365 IMDM for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88423 Vascular Cell Basal Medium ATCC Cat#PCS-100-030 Microvascular Endothelial Cell Growth Kit-VEGF ATCC Cat#PCS-110-041 Fetal bovine serum (FBS) Atlanta Biologicals Cat#S11150 Penicillin-Streptomycin (10,000 U/mL) Gibco/ThermoFisher Cat#15140122 1× RBC Lysis Buffer Invitrogen/ThermoFisher Cat#00-4333-57 FuGENE 6 transfection reagent Promega Cat#E2691 Dynabeads Human T-Activator CD3/CD28 ThermoFisher Cat#11131D Dynabeads Mouse T-Activator CD3/CD28 ThermoFisher Cat#11452D Recombinant human IL-2 PeproTech Cat#200-02 UltraComp eBeads Plus Compensation Beads ThermoFisher Cat#01-3333-41 T-PER Tissue Protein Extraction Reagent ThermoFisher Cat#78510 TRIzol Reagent ThermoFisher Cat#15596026 Laemmli Sample Buffer (4×) Bio-Rad Cat#1610747 L-[2,3,4-3H]-Arginine monohydrochloride PerkinElmer/Revvity Cat#NET1123250UC Alt-R S.p. .. Cas9 Nuclease V3 Integrated DNA Technologies Cat#1081058 P3 Primary Cell 4D-Nucleofector X Kit Lonza Cat#V4XP-3024 eBioscience Fixable Viability Dye eFluor 780 ThermoFisher Cat#65-0865-14 DAPI ThermoFisher Cat#D1306 7-AAD ThermoFisher Cat#A1310 SurePAGETM, Bis-Tris, 10 × 8, 4-12%, 15 wells GenScript Cat#M00654 Critical commercial assays CellTiter-Glo 2.0 Cell Viability Assay Promega Cat#G9241 2′3′-cGAMP ELISA kit Cayman Chemical Cat#501700 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 RosetteSep Human T cell Enrichment Cocktail StemCell Technologies Cat#15061 SepMate-50 PBMC isolation tubes StemCell Technologies Cat#85450 MojoSort Mouse CD4 T cell Isolation Kit BioLegend Cat#480033 MojoSort Mouse CD8 T cell Isolation Kit BioLegend Cat#480035 Direct-zol RNA MiniPrep Kit Zymo Research Cat#R2050 Maxima First Strand cDNA Synthesis Kit for RTqPCR ThermoFisher Cat#K1672 AccuPower GreenStar RT-qPCR Master Mix Bioneer Cat#K-6403 Gibson Assembly HiFi DNA Master Mix New England Biolabs Cat#E2621 QIAamp DNA Blood Maxi Kit QIAGEN Cat#51194 NextSeq 500/550 Mid Output v2 kit Illumina Cat#FC-404-2001 Deposited data Uncropped Western blot images This paper Mendeley Data: https://doi.org/10.17632/ trrgvjfbx3.2 Bulk RNA-seq: resting vs. activated human T cells This paper GEO: GSE325689 Bulk RNA-seq: SLC7A1- and SLC7A2overexpressing U937 SLC19A1− /− cells This paper GEO: GSE325690 sgRNA counts from CRISPR live/dead screen This paper Table S2 (Continued on next page) Cell Reports 45, 117580, July 28, 2026 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human immune cell transcript database (DICE) Schmiedel et al.33 https://dice-database.org/ Human T cell proteomic database Cano-Gamez et al.39 https://cytokines.cellgeni.sanger.ac.uk/ Human Protein Atlas v25.0 Jin et al.40 https://proteinatlas.org AlphaFold structure of human SLC7A1 Jumper et al.41 UniProt: P30825 AlphaFold structure of human SLC7A2 Jumper et al.41 UniProt: P52569 Geobacillus LAT crystal structure (arginine-bound) Jungnickel et al.37 PDB: 6F34 Experimental models: Cell lines Human: U937 SLC19A1− /− Ritchie et al.31 N/A Human: HEK293T ATCC Cat#CRL-3216; RRID:CVCL_0063 Human: Jurkat E6-1 ATCC Cat#TIB-152; RRID:CVCL_0367 Human: TIME (telomerase-immortalized microvascular endothelial) ATCC Cat#CRL-4025; RRID:CVCL_0047 Human: OCI-Ly7 DSMZ Cat#ACC688 Mouse: BV-2 Accegen Cat#ABC-TC212S Experimental models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory Strain#000664; RRID:IMSR_JAX:000664
Article Title: Intra-tumoral hypoxia promotes CD8 + T cell dysfunction via chronic activation of integrated stress response transcription factor ATF4.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Human pleomorphic undifferentiated high-grade deep sarcomas University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Human blood (matched to tumor) University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Chemical, peptide and recombinant proteins Recombinant human IL-2 NCI: Biological Resources Branch Ro 23-6019 GolgiPlug Protein Transport Inhibitor (Brefeldin A) BD Biosciences Cat# 51-2301KZ Cell Stimulation Cocktail ThermoFisher Cat# 00-4970-93 Pierce RIPA Buffer Thermo Scientific Cat# 89900 Protease Inhibitor Cocktail Cell Signaling Technology Cat# 5871 Phosphatase Inhibitor Cocktail I Sigma Aldrich Cat# P2850 Phosphatase Inhibitor Cocktail II Sigma Aldrich Cat# P5726 OVA peptide (OVA 257-267) InvivoGen Cat# vac-sin Geneticin Selective Antibiotic ThermoFisher Cat# 10131-035 Seahorse XF DMEM Medium, pH 7.4 Agilent Cat# 103575-100 CellTak Cell and Tissue Adhesive Corning Cat# 354240 Histopaque-1077 Sigma Aldrich Cat# 10771 N-acetyl-L-cysteine Sigma Aldrich Cat# A9165 Percoll Cytiva Cat# 17089101 Critical commercial assays UltraComp eBeads Plus Compensation Beads ThermoFisher Cat# 1333342 Foxp3/Transcription Factor Fixation/ Permeabilization Kit ThermoFisher Cat# 00-5521-00 Pierce BCA Protein Assay Kit ThermoFisher Cat# 23225 Seahorse XFe96 FluxPak Mini Agilent Technologies Cat# 102601-100 Zombie NIR Viability Stain Biolegend Cat# 420106 MitoSox Mitochondrial Superoxide Indicator ThermoFisher Cat# M36008 RNeasy RNA Isolation Kit Qiagen Cat# 74104 High Capacity RNA-to-cDNA Kit ThermoFisher Cat# 4387406 Taqman single gene expression qPCR Mastermix ThermoFisher Cat# 4440040 Mouse Tumor Dissociation Kit Miltenyi Biotec Cat# 130-096-730 Human Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 EasySep Mouse CD8 + T Cell Isolation Kit Stemcell Technologies Cat# 19853 P3 Primary Cell 4D Nucleofector X Kit S Lonza Cat# V4XP-3032 Alt-R Sp Cas9 Nuclease V3 IDT Cat# 1081059 ISRIB Sigma Aldrich Cat# SML0843 eBioscience Annexin V-FITC Apoptosis Detection Kit ThermoFisher Cat# 88-8103-72 eBioscience BrdU Staining Kit for Flow Cytometry APC ThermoFisher Cat# 8817-6600-42 GSK2606414 (PERKi) Selleckchem Cat# S7307 GCN2iB Selleckchem Cat# S8929 PKR-IN-C16 Selleckchem Cat# S9668 Mouse T cell Activator CD3/CD28 Dynabeads ThermoFisher Cat# 11452D Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat# RPN2232 OPAL 6-plex detection kit Akoya Cat# NEL8710011KT Bond dewax solution Leica Cat# AR9222 (Continued on next page) e2 Immunity 58, 1–16.e1–e8, October 14, 2025 .. E8Icre (C57BL/6-Tg(Cd8a-cre)1Itan/J), ATF4 Tg/Tg (C57BL/6;129X1-Gt(ROSA)26Sor tm2(ATF4)Myz /J), ATF4 f/f (C57BL/6-Atf4 tm1.1Cmad /J), OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J), CD45.1 (C57BL/6.SJL-Ptprc a Pepc b /BoyJ), and C57BL/6 mice were obtained from Jackson Laboratories.
Mutagenesis:Article Title: Cereblon-based KRAS degrading PROTACs and uses related thereto
Article Snippet: Densitometry analysis was done using ImageJ software, all samples were normalized to vinculin loading control and then graphed as a percent of control as compared to vehicle treated tumors. .. Reagents for Cell Culture/Implantation DMEM—Gibco/ThermoFisher #10566016 RPMI-1640—Gibco/ThermoFisher #61870036 DMEM/F12—Gibco/ThermoFisher #10565018 DMEM (phenol red-free)—Gibco/ThermoFisher #21063029 RPMI-1640 (phenol red-free) Gibco/ThermoFisher #11835030 DPBS—Gibco/ThermoFisher #14190144 Trypsin/EDTA—Gibco/ThermoFisher #25200056 FBS—Gibco/ThermoFisher #26140079 Penicillin-Streptomycin (PenStrep)—Gibco/ThermoFisher #15140122 Human EGF recombinant protein—Gibco/ThermoFisher #PHG0315 EMEM—ATCC #302003 RPMI-1640—ATCC #302001 Hydrocortisone—Millipore Sigma #H0135-1 mg Insulin solution, human—Millipore Sigma #19278-5 ml ITS supplement—R&D Systems #AR013 Matrigel—Corning #354234 HYPER flask—Corning #10034 Reagents for Tumor Western Blots RIPA buffer—ThermoFisher #89900 HALT protease inhibitor—ThermoFisher #78437 HALT phosphatase inhibitor—Thermofisher #78420 EDTA, 0.5M—Thermofisher #1861275 BCA Protein Assay kit—ThermoFisher #23225 NuPAGE 4×LDS sample buffer—ThermoFisher #NP0007 Bolt 10×sample reducing agent—Thermofisher #B0009 NuPAGE 4-12% Bis-Tris Midi gel, 26 well—ThermoFisher #WG1403BX10 BioRad Precision Plus Dual Color ladder—BioRad #1610374 Trans-blot midi Nitrocellulose transfer pack—Biorad #1704159 MOPS/SDS running buffer—Thermofisher #NP0001-02 SuperSignalTM West Femto—ThermoFisher #34095 TBS-T (1×TBS with 0.1% tween-20) BSA, bovine serum albumin, fraction V—AmericanBio #AB00440-01000 5 mm stainless steel bead—Qiagen #69989 Ras (G12D mutant specific)(D8H7) Rabbit mAb—Cell Signaling Technology #14429S Vinculin (E1E9V) XP Rabbit mAb—Cell Signaling Technology #13901S Anti-rabbit IgG, HRP-linked Antibody—Cell Signaling Technology #7074P2 The disclosed subject matter is not to be limited in scope by the specific embodiments and examples described herein. ..
Protease Inhibitor:Article Title: RNA virus polymerase-helicase coupling enables rapid elongation through duplex RNA.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Digoxigenin Roche Cat # 11333089001, RRID:AB_514496 Chemicals, peptides, and recombinant proteins HEPES Carl Roth CAS # 7365-45-9 Tris Carl Roth CAS # 77-86-1 Sodium Chloride Carl Roth CAS # 7647-14-5 Potassium Glutamate Sigma-Aldrich CAS # 6382-01-0 Magnesium Chloride Carl Roth CAS # 7791-18-6 Zink Sulfate Sigma-Aldrich Cat # 221376 Dextrose Fisher Cat # D16-1 Sodium Phosphate-monobasic Fisher Cat # P285-500 Sodium Phosphate-dibasic Fisher Cat # S375-500 Ammonium Sulfate Fisher Cat # A702-500 Glycerol Fisher Cat # G153-4 Tris (2-Carboxyethyl) phosphine Hydrochloride (TCEP) GoldBio Cat # TCEP1 EDTA Carl Roth CAS # 6381-92-6 Bovine Serum Albumin Carl Roth CAS # 90604-29-8 NTP Promega Cat # P1132 Biotin-16-UTP Jena Bioscience NU-821-BIO16 Digoxigenin-11-UTP Jena Bioscience NU-821-DIGX RNA 5′ Polyphosphatase Biosearch technologies RP8092H T4 Polynucleotide Kinase New England Biolabs Cat # M0201 T4 RNA ligase 2 New England Biolabs Cat # M0239 Ulp1 peptidase Byrd et al.39 N/A Phosphocellulose (P-11) Whatman, Sigma-Aldrich Cat # Z753807 Agarose Sigma-Aldrich Cat # A9539 TAE buffer 50× ThermoFisher Cat # B49 TBE buffer 10× Roth Cat # 3061 RNA Gel Loading Dye (2X) ThermoFisher Cat # R0641 SyBrSafe Nucleic Acid Gel Stain Invitrogen, ThermoFisher Cat # S33102 The RNA storage solution Thermo Scientific Cat # AM7001 Strep-Tactin Superflow resin IBA LifeSciences Cat # 21208 Ni-NTA agarose beads Qiagen Cat # 36113 BioLock IBA Lifesciences Cat # 2-0205-050 Dithiothreitol (DTT) ThermoFisher Cat # R0861 isopropyl β-D-1-thiogalactopyranoside (IPTG) Biopioneer Cat # C0012-100 phenylmethylsulfonyl fluoride (PMSF) Sigma-Aldrich Cat # P7626-25G Kanamycin sulfate Fisher Cat # BP906-5 chloramphenicol Fisher Cat # BP904-100 β-mercaptoethanol ThermoScientific Cat # 125472500 Desthiobiotin IBA Lifesciences Cat # 2-1000-002 imidazole ThermoFisher Cat # A10221.36 Polyethyleneimine (PEI) Sigma-Aldrich CAS # 26658-46-8 1% w/w TEV protease Kirchdoerfer et al.8 N/A (Continued on next page) 12 Cell Reports 45, 117273, April 28, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Protease Inhibitor Tablets, EDTA-free Pierce, ThermoFisher Cat # A32965 NZCYM Broth Research Products International SKU # N72000-250.0 Critical commercial assays Phusion High-Fidelity PCR kit New England Biolabs Cat # E0553 Monarch PCR & DNA Cleanup Kit New England Biolabs Cat # T1030 HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs Cat # E2040 RNA Clean & Concentrator Zymo Research Cat # R1015, R1017 pET-46 Ek/LIC Vector Kit Novagen Cat # 71335 pFastBac Dual Expression Vector Life Technologies Cat # 10712024 MAX Efficiency DH10Bac Competent Cells Life Technologies Cat # 10361012 Cellfectin II Reagent Life Technologies Cat # 10362100 pSUMO plasmid LifeSensors Cat # pE1001K QuikChange II Site-Directed Mutagenesis Kit Agilent Technologies Cat # 200523 Superdex 200 Increase 10/300 GL GE Life Sciences Cat # GE28-9909-44 HisTrap FF column Cytiva Cat # 17525501 HiTrap SP Sepharos FF column Cytiva Cat # 17515701 Sephacyl S200-HR HiPrep 16/60 column Cytiva Cat # 17116601 Pierce BCA Protein Assay Kit ThermoFisher Cat # 23225 Deposited data All data obtained in this study This study https://doi.org/10.48338/VU01-DY3HI3 Experimental models: Cell lines Sf9 cells Expression Systems Cat # 94-001F Sf21 cells Expression Systems Cat # 94-003F Oligonucleotides K288A SDM- Forward Primer- GCCGGGTACC GGCGCGAGCCACTTTGCG IDT N/A K288A SDM Reverse Primer - CGCAAAGTG GCTCGCGCCGGTACCCGGC IDT N/A Oligo’s for dsRNA template and RNA hairpins (Table S1) Biomers N/A Recombinant DNA pFastBac DNAs with nsp12 gene, double TEV site and strep-tag Genscript GenBank MN985325 nsp7 genes cloned into pET46 with an N-terminal 6× histidine tag, enterokinase site, TEV site Novagen GenBank MN985325 nsp8 genes cloned into pET46 with an N-terminal 6× histidine tag, enterokinase site, TEV site Novagen GenBank MN985325 nsp13 gene from SARS-CoV-2 Washington isolate as E. coli codon-optimized fragment GenScript GenBank MN985325 pBAD/Myc-HisB plasmid (Invitrogen) with mukB-His10 Papini et al.40 N/A pMK-T (ColE1 ori, KanR) plasmid (ThermoFisher) with a palindromic sequence Papini et al.40 N/A Software and algorithms Python 3 Python Software Foundation https://www.python.org/download/ releases/3.0/ labVIEW National Instruments41 https://www.ni.com/en-us.html Bead-tracking software in labVIEW Cnossen et al.42 http://www.github.com/jcnossen/ BeadTracker (Continued on next page) Cell Reports 45, 117273, April 28, 2026 13 ..
Article Title: Intra-tumoral hypoxia promotes CD8 + T cell dysfunction via chronic activation of integrated stress response transcription factor ATF4.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Human pleomorphic undifferentiated high-grade deep sarcomas University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Human blood (matched to tumor) University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Chemical, peptide and recombinant proteins Recombinant human IL-2 NCI: Biological Resources Branch Ro 23-6019 GolgiPlug Protein Transport Inhibitor (Brefeldin A) BD Biosciences Cat# 51-2301KZ Cell Stimulation Cocktail ThermoFisher Cat# 00-4970-93 Pierce RIPA Buffer Thermo Scientific Cat# 89900 Protease Inhibitor Cocktail Cell Signaling Technology Cat# 5871 Phosphatase Inhibitor Cocktail I Sigma Aldrich Cat# P2850 Phosphatase Inhibitor Cocktail II Sigma Aldrich Cat# P5726 OVA peptide (OVA 257-267) InvivoGen Cat# vac-sin Geneticin Selective Antibiotic ThermoFisher Cat# 10131-035 Seahorse XF DMEM Medium, pH 7.4 Agilent Cat# 103575-100 CellTak Cell and Tissue Adhesive Corning Cat# 354240 Histopaque-1077 Sigma Aldrich Cat# 10771 N-acetyl-L-cysteine Sigma Aldrich Cat# A9165 Percoll Cytiva Cat# 17089101 Critical commercial assays UltraComp eBeads Plus Compensation Beads ThermoFisher Cat# 1333342 Foxp3/Transcription Factor Fixation/ Permeabilization Kit ThermoFisher Cat# 00-5521-00 Pierce BCA Protein Assay Kit ThermoFisher Cat# 23225 Seahorse XFe96 FluxPak Mini Agilent Technologies Cat# 102601-100 Zombie NIR Viability Stain Biolegend Cat# 420106 MitoSox Mitochondrial Superoxide Indicator ThermoFisher Cat# M36008 RNeasy RNA Isolation Kit Qiagen Cat# 74104 High Capacity RNA-to-cDNA Kit ThermoFisher Cat# 4387406 Taqman single gene expression qPCR Mastermix ThermoFisher Cat# 4440040 Mouse Tumor Dissociation Kit Miltenyi Biotec Cat# 130-096-730 Human Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 EasySep Mouse CD8 + T Cell Isolation Kit Stemcell Technologies Cat# 19853 P3 Primary Cell 4D Nucleofector X Kit S Lonza Cat# V4XP-3032 Alt-R Sp Cas9 Nuclease V3 IDT Cat# 1081059 ISRIB Sigma Aldrich Cat# SML0843 eBioscience Annexin V-FITC Apoptosis Detection Kit ThermoFisher Cat# 88-8103-72 eBioscience BrdU Staining Kit for Flow Cytometry APC ThermoFisher Cat# 8817-6600-42 GSK2606414 (PERKi) Selleckchem Cat# S7307 GCN2iB Selleckchem Cat# S8929 PKR-IN-C16 Selleckchem Cat# S9668 Mouse T cell Activator CD3/CD28 Dynabeads ThermoFisher Cat# 11452D Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat# RPN2232 OPAL 6-plex detection kit Akoya Cat# NEL8710011KT Bond dewax solution Leica Cat# AR9222 (Continued on next page) e2 Immunity 58, 1–16.e1–e8, October 14, 2025 .. E8Icre (C57BL/6-Tg(Cd8a-cre)1Itan/J), ATF4 Tg/Tg (C57BL/6;129X1-Gt(ROSA)26Sor tm2(ATF4)Myz /J), ATF4 f/f (C57BL/6-Atf4 tm1.1Cmad /J), OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J), CD45.1 (C57BL/6.SJL-Ptprc a Pepc b /BoyJ), and C57BL/6 mice were obtained from Jackson Laboratories.
Polymerase Chain Reaction:Article Title: RNA virus polymerase-helicase coupling enables rapid elongation through duplex RNA.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Digoxigenin Roche Cat # 11333089001, RRID:AB_514496 Chemicals, peptides, and recombinant proteins HEPES Carl Roth CAS # 7365-45-9 Tris Carl Roth CAS # 77-86-1 Sodium Chloride Carl Roth CAS # 7647-14-5 Potassium Glutamate Sigma-Aldrich CAS # 6382-01-0 Magnesium Chloride Carl Roth CAS # 7791-18-6 Zink Sulfate Sigma-Aldrich Cat # 221376 Dextrose Fisher Cat # D16-1 Sodium Phosphate-monobasic Fisher Cat # P285-500 Sodium Phosphate-dibasic Fisher Cat # S375-500 Ammonium Sulfate Fisher Cat # A702-500 Glycerol Fisher Cat # G153-4 Tris (2-Carboxyethyl) phosphine Hydrochloride (TCEP) GoldBio Cat # TCEP1 EDTA Carl Roth CAS # 6381-92-6 Bovine Serum Albumin Carl Roth CAS # 90604-29-8 NTP Promega Cat # P1132 Biotin-16-UTP Jena Bioscience NU-821-BIO16 Digoxigenin-11-UTP Jena Bioscience NU-821-DIGX RNA 5′ Polyphosphatase Biosearch technologies RP8092H T4 Polynucleotide Kinase New England Biolabs Cat # M0201 T4 RNA ligase 2 New England Biolabs Cat # M0239 Ulp1 peptidase Byrd et al.39 N/A Phosphocellulose (P-11) Whatman, Sigma-Aldrich Cat # Z753807 Agarose Sigma-Aldrich Cat # A9539 TAE buffer 50× ThermoFisher Cat # B49 TBE buffer 10× Roth Cat # 3061 RNA Gel Loading Dye (2X) ThermoFisher Cat # R0641 SyBrSafe Nucleic Acid Gel Stain Invitrogen, ThermoFisher Cat # S33102 The RNA storage solution Thermo Scientific Cat # AM7001 Strep-Tactin Superflow resin IBA LifeSciences Cat # 21208 Ni-NTA agarose beads Qiagen Cat # 36113 BioLock IBA Lifesciences Cat # 2-0205-050 Dithiothreitol (DTT) ThermoFisher Cat # R0861 isopropyl β-D-1-thiogalactopyranoside (IPTG) Biopioneer Cat # C0012-100 phenylmethylsulfonyl fluoride (PMSF) Sigma-Aldrich Cat # P7626-25G Kanamycin sulfate Fisher Cat # BP906-5 chloramphenicol Fisher Cat # BP904-100 β-mercaptoethanol ThermoScientific Cat # 125472500 Desthiobiotin IBA Lifesciences Cat # 2-1000-002 imidazole ThermoFisher Cat # A10221.36 Polyethyleneimine (PEI) Sigma-Aldrich CAS # 26658-46-8 1% w/w TEV protease Kirchdoerfer et al.8 N/A (Continued on next page) 12 Cell Reports 45, 117273, April 28, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Protease Inhibitor Tablets, EDTA-free Pierce, ThermoFisher Cat # A32965 NZCYM Broth Research Products International SKU # N72000-250.0 Critical commercial assays Phusion High-Fidelity PCR kit New England Biolabs Cat # E0553 Monarch PCR & DNA Cleanup Kit New England Biolabs Cat # T1030 HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs Cat # E2040 RNA Clean & Concentrator Zymo Research Cat # R1015, R1017 pET-46 Ek/LIC Vector Kit Novagen Cat # 71335 pFastBac Dual Expression Vector Life Technologies Cat # 10712024 MAX Efficiency DH10Bac Competent Cells Life Technologies Cat # 10361012 Cellfectin II Reagent Life Technologies Cat # 10362100 pSUMO plasmid LifeSensors Cat # pE1001K QuikChange II Site-Directed Mutagenesis Kit Agilent Technologies Cat # 200523 Superdex 200 Increase 10/300 GL GE Life Sciences Cat # GE28-9909-44 HisTrap FF column Cytiva Cat # 17525501 HiTrap SP Sepharos FF column Cytiva Cat # 17515701 Sephacyl S200-HR HiPrep 16/60 column Cytiva Cat # 17116601 Pierce BCA Protein Assay Kit ThermoFisher Cat # 23225 Deposited data All data obtained in this study This study https://doi.org/10.48338/VU01-DY3HI3 Experimental models: Cell lines Sf9 cells Expression Systems Cat # 94-001F Sf21 cells Expression Systems Cat # 94-003F Oligonucleotides K288A SDM- Forward Primer- GCCGGGTACC GGCGCGAGCCACTTTGCG IDT N/A K288A SDM Reverse Primer - CGCAAAGTG GCTCGCGCCGGTACCCGGC IDT N/A Oligo’s for dsRNA template and RNA hairpins (Table S1) Biomers N/A Recombinant DNA pFastBac DNAs with nsp12 gene, double TEV site and strep-tag Genscript GenBank MN985325 nsp7 genes cloned into pET46 with an N-terminal 6× histidine tag, enterokinase site, TEV site Novagen GenBank MN985325 nsp8 genes cloned into pET46 with an N-terminal 6× histidine tag, enterokinase site, TEV site Novagen GenBank MN985325 nsp13 gene from SARS-CoV-2 Washington isolate as E. coli codon-optimized fragment GenScript GenBank MN985325 pBAD/Myc-HisB plasmid (Invitrogen) with mukB-His10 Papini et al.40 N/A pMK-T (ColE1 ori, KanR) plasmid (ThermoFisher) with a palindromic sequence Papini et al.40 N/A Software and algorithms Python 3 Python Software Foundation https://www.python.org/download/ releases/3.0/ labVIEW National Instruments41 https://www.ni.com/en-us.html Bead-tracking software in labVIEW Cnossen et al.42 http://www.github.com/jcnossen/ BeadTracker (Continued on next page) Cell Reports 45, 117273, April 28, 2026 13 ..
Viability Assay:Article Title: Activation-induced SLC7A1 expression enhances T cell sensitivity to cGAMP-mediated STING signaling.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Poly-D-lysine Gibco/ThermoFisher Cat#A3890401 DMEM Corning Cat#10-013-CV RPMI 1640 Corning Cat#10-040-CV IMDM Corning Cat#10-016-CV RPMI 1640 for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88365 IMDM for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88423 Vascular Cell Basal Medium ATCC Cat#PCS-100-030 Microvascular Endothelial Cell Growth Kit-VEGF ATCC Cat#PCS-110-041 Fetal bovine serum (FBS) Atlanta Biologicals Cat#S11150 Penicillin-Streptomycin (10,000 U/mL) Gibco/ThermoFisher Cat#15140122 1× RBC Lysis Buffer Invitrogen/ThermoFisher Cat#00-4333-57 FuGENE 6 transfection reagent Promega Cat#E2691 Dynabeads Human T-Activator CD3/CD28 ThermoFisher Cat#11131D Dynabeads Mouse T-Activator CD3/CD28 ThermoFisher Cat#11452D Recombinant human IL-2 PeproTech Cat#200-02 UltraComp eBeads Plus Compensation Beads ThermoFisher Cat#01-3333-41 T-PER Tissue Protein Extraction Reagent ThermoFisher Cat#78510 TRIzol Reagent ThermoFisher Cat#15596026 Laemmli Sample Buffer (4×) Bio-Rad Cat#1610747 L-[2,3,4-3H]-Arginine monohydrochloride PerkinElmer/Revvity Cat#NET1123250UC Alt-R S.p. .. Cas9 Nuclease V3 Integrated DNA Technologies Cat#1081058 P3 Primary Cell 4D-Nucleofector X Kit Lonza Cat#V4XP-3024 eBioscience Fixable Viability Dye eFluor 780 ThermoFisher Cat#65-0865-14 DAPI ThermoFisher Cat#D1306 7-AAD ThermoFisher Cat#A1310 SurePAGETM, Bis-Tris, 10 × 8, 4-12%, 15 wells GenScript Cat#M00654 Critical commercial assays CellTiter-Glo 2.0 Cell Viability Assay Promega Cat#G9241 2′3′-cGAMP ELISA kit Cayman Chemical Cat#501700 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 RosetteSep Human T cell Enrichment Cocktail StemCell Technologies Cat#15061 SepMate-50 PBMC isolation tubes StemCell Technologies Cat#85450 MojoSort Mouse CD4 T cell Isolation Kit BioLegend Cat#480033 MojoSort Mouse CD8 T cell Isolation Kit BioLegend Cat#480035 Direct-zol RNA MiniPrep Kit Zymo Research Cat#R2050 Maxima First Strand cDNA Synthesis Kit for RTqPCR ThermoFisher Cat#K1672 AccuPower GreenStar RT-qPCR Master Mix Bioneer Cat#K-6403 Gibson Assembly HiFi DNA Master Mix New England Biolabs Cat#E2621 QIAamp DNA Blood Maxi Kit QIAGEN Cat#51194 NextSeq 500/550 Mid Output v2 kit Illumina Cat#FC-404-2001 Deposited data Uncropped Western blot images This paper Mendeley Data: https://doi.org/10.17632/ trrgvjfbx3.2 Bulk RNA-seq: resting vs. activated human T cells This paper GEO: GSE325689 Bulk RNA-seq: SLC7A1- and SLC7A2overexpressing U937 SLC19A1− /− cells This paper GEO: GSE325690 sgRNA counts from CRISPR live/dead screen This paper Table S2 (Continued on next page) Cell Reports 45, 117580, July 28, 2026 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human immune cell transcript database (DICE) Schmiedel et al.33 https://dice-database.org/ Human T cell proteomic database Cano-Gamez et al.39 https://cytokines.cellgeni.sanger.ac.uk/ Human Protein Atlas v25.0 Jin et al.40 https://proteinatlas.org AlphaFold structure of human SLC7A1 Jumper et al.41 UniProt: P30825 AlphaFold structure of human SLC7A2 Jumper et al.41 UniProt: P52569 Geobacillus LAT crystal structure (arginine-bound) Jungnickel et al.37 PDB: 6F34 Experimental models: Cell lines Human: U937 SLC19A1− /− Ritchie et al.31 N/A Human: HEK293T ATCC Cat#CRL-3216; RRID:CVCL_0063 Human: Jurkat E6-1 ATCC Cat#TIB-152; RRID:CVCL_0367 Human: TIME (telomerase-immortalized microvascular endothelial) ATCC Cat#CRL-4025; RRID:CVCL_0047 Human: OCI-Ly7 DSMZ Cat#ACC688 Mouse: BV-2 Accegen Cat#ABC-TC212S Experimental models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory Strain#000664; RRID:IMSR_JAX:000664
Article Title: Coxsackievirus B infection invokes unique cell-type-specific responses in primary human pancreatic islets.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TotalSeq TM -A0251 anti-human Hashtag 1 Antibody BioLegend 394601; RRID: AB_2750015 TotalSeq TM -A0252 anti-human Hashtag 2 Antibody BioLegend 394603; RRID: AB_2750016 TotalSeq TM -A0253 anti-human Hashtag 3 Antibody BioLegend 394605; RRID: AB_2750017 TotalSeq TM -A0254 anti-human Hashtag 4 Antibody BioLegend 394607; RRID: AB_2750018 TotalSeq TM -A0255 anti-human Hashtag 5 Antibody BioLegend 394609; RRID: AB_2750019 TotalSeq TM -A0256 anti-human Hashtag 6 Antibody BioLegend 394611; RRID: AB_2750020 LC3B Antibody Cell Signaling Cat#2775S; RRID: AB_915950 Anti-SQSTM1/P62 Antibody [2C11] Abcam Cat#Ab56416; RRID: AB_945626 GAPDH (14C10 Rabbit mAb Cell Signaling Cat#2118S; RRID: AB_561053 HRP-linked anti-mouse igG antibody Cell Signaling Cat#7076S; RRID: AB_330924 HRP-linked anti-rabbit igG antibody Cell Signaling Cat#7074S; RRID: AB_2099233 Bacterial and virus strains CVB3-EGFP Hubert Tse N/A One Shot TM Stb13 TM Chemically Competent cells Invitrogen Cat#C737303 Biological samples Healthy primary human islets Prodo Laboratories Inc. N/A Chemicals, peptides, and recombinant proteins CMRL 1066 Corning Cat#99-603-CV mTeSR1 Stem Cell Technologies Cat#05850 TrypLE Express Life Technologies Cat#12604039 Y-27632 Pepro Tech Cat#129382310MG hESC-qualified Corning Matrigel Matrix Corning Cat#354277 Polyinosinic-polycytidylic acid [poly(I:C)] InvivoGen Cat#tlrl-piclv 1X PBS Corning Cat#21-030-CV DNase Qiagen Cat#79254 PowerUP SYBR Green Master Mix Life Technologies Cat#A25742 XF calibrant solution Agilent Cat#100840-000 Seahorse XF RPMI Agilent Cat#103576-100 Oligomycin Sigma Cat#O4876 FCCP & rotenone Sigma Cat#R8875 Antimycin A Sigma Cat#A8674 Heat-inactivated FBS MilliporeSigma Cat#F4135 Sodium pyruvate Corning Cat#25-000-CL Polyethylenimine Max Polysciences Cat#24765-2 Lenti-X concentrator Takara Cat#631232 Lenti-X GoStix Plus Takara Cat#631280 Lysis Buffer Cell Signaling Cat#9803 Protease inhibitor Sigma Cat#118336170001 4-12% Bolt Bis-Tris Plus Mini Protein Gel ThermoFisher Cat#NW04120BOX; Cat#NW04122BOX PVDF membrane Bio-Rad Cat#1620177 Cytiva Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat#RPN2232 Critical commercial assays RNeasy Mini Kit Qiagen Cat#74106 (Continued on next page) 16 Cell Reports 44, 116211, September 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER High-Capacity cDNA Reverse Transcriptase Kit Applied Biosystems Cat#4368813 Chromium Single Cell 3 ′ V3.1 Library and Gel Bead Kit 10X Genomics Cat#PN-1000128 Dihydroethidium assay kit Abcam Cat#ab236206 QIAprep Miniprep kit Qiagen Cat#27115 Qiagen Maxi plus kit Qiagen Cat#12981 CellTiter-Fluor Cell Viability Assay Promega Cat#G6080 Caspase-Glo 3/7 Assay System Promega Cat#G8090 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 Deposited data Raw and processed scRNA-seq and bulkRNA-seq data This Paper GEO: GSE274264 Raw and processed scRNA-seq data – Human Islets Xin et al. 44 GEO: GSE114297 Raw and processed scRNA-seq data- Human Islets Maestas et al. 39 GEO: GSE237448 Experimental models: Cell lines Human: HUES8 hESC HSCI hES Cell Line: HUES-8 Oligonucleotides See Data S1 for primers used in this study This paper N/A Recombinant DNA MIR7-3HG-sh-1 (CCTTCTTCTGCAAGCTCCATT) MilliporeSigma TRCN0000172497 MIR7-3HG-sh-2 (CGAAGTTTGACGGTCTGGAAA) Millipore Sigma TRCN0000173026 pMD2.G Didier Trono Addgene #12259 psPAX2 Didier Trono Addgene #12260 Software and algorithms Seurat V4.3.0.1 Hao et al. 106 https://satijalab.org/seurat/articles/ install_v5 R V4.0.3 R https://cran.rstudio.com/bin/windows/ base/old/4.0.3/ R Studio V1.3.1093 RStudio https://posit.co/download/rstudio- desktop/ Progeny Schubert et al. 45 https://www.bioconductor.org/packages/ release/bioc/html/progeny.html#:∼:text= PROGENy%20is%20resource%20that%20 leverages%20a%20large%20compendium, of%20pathway%20responsive%20genes %20for%20human%20and%20mouse. .. Monocle 3 V1.2.9 Cao et al. 48 https://cole-trapnell-lab.github.io/monocle3/ docs/installation/ Fiji ImageJ ImageJ Public freeware https://fiji.sc/ Other V-bottom 96-well plate Corning Cat#3894 Black, clear bottom 96-well plate Costar Cat#3875 Seahorse XF24 islet Capture Microplates Agilent Cat#101122-100 OCR stats Yé pez et al. 46 https://github.com/vyepez88/OCR- Stats?tab=readme-ov-file Lenti-X 293T cells Takara Cat#632180 White, clear bottom 96-well plate Corning Cat#3903 Cell Reports 44, 116211, September 23, 2025 17
Enzyme-linked Immunosorbent Assay:Article Title: Activation-induced SLC7A1 expression enhances T cell sensitivity to cGAMP-mediated STING signaling.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Poly-D-lysine Gibco/ThermoFisher Cat#A3890401 DMEM Corning Cat#10-013-CV RPMI 1640 Corning Cat#10-040-CV IMDM Corning Cat#10-016-CV RPMI 1640 for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88365 IMDM for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88423 Vascular Cell Basal Medium ATCC Cat#PCS-100-030 Microvascular Endothelial Cell Growth Kit-VEGF ATCC Cat#PCS-110-041 Fetal bovine serum (FBS) Atlanta Biologicals Cat#S11150 Penicillin-Streptomycin (10,000 U/mL) Gibco/ThermoFisher Cat#15140122 1× RBC Lysis Buffer Invitrogen/ThermoFisher Cat#00-4333-57 FuGENE 6 transfection reagent Promega Cat#E2691 Dynabeads Human T-Activator CD3/CD28 ThermoFisher Cat#11131D Dynabeads Mouse T-Activator CD3/CD28 ThermoFisher Cat#11452D Recombinant human IL-2 PeproTech Cat#200-02 UltraComp eBeads Plus Compensation Beads ThermoFisher Cat#01-3333-41 T-PER Tissue Protein Extraction Reagent ThermoFisher Cat#78510 TRIzol Reagent ThermoFisher Cat#15596026 Laemmli Sample Buffer (4×) Bio-Rad Cat#1610747 L-[2,3,4-3H]-Arginine monohydrochloride PerkinElmer/Revvity Cat#NET1123250UC Alt-R S.p. .. Cas9 Nuclease V3 Integrated DNA Technologies Cat#1081058 P3 Primary Cell 4D-Nucleofector X Kit Lonza Cat#V4XP-3024 eBioscience Fixable Viability Dye eFluor 780 ThermoFisher Cat#65-0865-14 DAPI ThermoFisher Cat#D1306 7-AAD ThermoFisher Cat#A1310 SurePAGETM, Bis-Tris, 10 × 8, 4-12%, 15 wells GenScript Cat#M00654 Critical commercial assays CellTiter-Glo 2.0 Cell Viability Assay Promega Cat#G9241 2′3′-cGAMP ELISA kit Cayman Chemical Cat#501700 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 RosetteSep Human T cell Enrichment Cocktail StemCell Technologies Cat#15061 SepMate-50 PBMC isolation tubes StemCell Technologies Cat#85450 MojoSort Mouse CD4 T cell Isolation Kit BioLegend Cat#480033 MojoSort Mouse CD8 T cell Isolation Kit BioLegend Cat#480035 Direct-zol RNA MiniPrep Kit Zymo Research Cat#R2050 Maxima First Strand cDNA Synthesis Kit for RTqPCR ThermoFisher Cat#K1672 AccuPower GreenStar RT-qPCR Master Mix Bioneer Cat#K-6403 Gibson Assembly HiFi DNA Master Mix New England Biolabs Cat#E2621 QIAamp DNA Blood Maxi Kit QIAGEN Cat#51194 NextSeq 500/550 Mid Output v2 kit Illumina Cat#FC-404-2001 Deposited data Uncropped Western blot images This paper Mendeley Data: https://doi.org/10.17632/ trrgvjfbx3.2 Bulk RNA-seq: resting vs. activated human T cells This paper GEO: GSE325689 Bulk RNA-seq: SLC7A1- and SLC7A2overexpressing U937 SLC19A1− /− cells This paper GEO: GSE325690 sgRNA counts from CRISPR live/dead screen This paper Table S2 (Continued on next page) Cell Reports 45, 117580, July 28, 2026 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human immune cell transcript database (DICE) Schmiedel et al.33 https://dice-database.org/ Human T cell proteomic database Cano-Gamez et al.39 https://cytokines.cellgeni.sanger.ac.uk/ Human Protein Atlas v25.0 Jin et al.40 https://proteinatlas.org AlphaFold structure of human SLC7A1 Jumper et al.41 UniProt: P30825 AlphaFold structure of human SLC7A2 Jumper et al.41 UniProt: P52569 Geobacillus LAT crystal structure (arginine-bound) Jungnickel et al.37 PDB: 6F34 Experimental models: Cell lines Human: U937 SLC19A1− /− Ritchie et al.31 N/A Human: HEK293T ATCC Cat#CRL-3216; RRID:CVCL_0063 Human: Jurkat E6-1 ATCC Cat#TIB-152; RRID:CVCL_0367 Human: TIME (telomerase-immortalized microvascular endothelial) ATCC Cat#CRL-4025; RRID:CVCL_0047 Human: OCI-Ly7 DSMZ Cat#ACC688 Mouse: BV-2 Accegen Cat#ABC-TC212S Experimental models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory Strain#000664; RRID:IMSR_JAX:000664
Isolation:Article Title: Activation-induced SLC7A1 expression enhances T cell sensitivity to cGAMP-mediated STING signaling.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Poly-D-lysine Gibco/ThermoFisher Cat#A3890401 DMEM Corning Cat#10-013-CV RPMI 1640 Corning Cat#10-040-CV IMDM Corning Cat#10-016-CV RPMI 1640 for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88365 IMDM for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88423 Vascular Cell Basal Medium ATCC Cat#PCS-100-030 Microvascular Endothelial Cell Growth Kit-VEGF ATCC Cat#PCS-110-041 Fetal bovine serum (FBS) Atlanta Biologicals Cat#S11150 Penicillin-Streptomycin (10,000 U/mL) Gibco/ThermoFisher Cat#15140122 1× RBC Lysis Buffer Invitrogen/ThermoFisher Cat#00-4333-57 FuGENE 6 transfection reagent Promega Cat#E2691 Dynabeads Human T-Activator CD3/CD28 ThermoFisher Cat#11131D Dynabeads Mouse T-Activator CD3/CD28 ThermoFisher Cat#11452D Recombinant human IL-2 PeproTech Cat#200-02 UltraComp eBeads Plus Compensation Beads ThermoFisher Cat#01-3333-41 T-PER Tissue Protein Extraction Reagent ThermoFisher Cat#78510 TRIzol Reagent ThermoFisher Cat#15596026 Laemmli Sample Buffer (4×) Bio-Rad Cat#1610747 L-[2,3,4-3H]-Arginine monohydrochloride PerkinElmer/Revvity Cat#NET1123250UC Alt-R S.p. .. Cas9 Nuclease V3 Integrated DNA Technologies Cat#1081058 P3 Primary Cell 4D-Nucleofector X Kit Lonza Cat#V4XP-3024 eBioscience Fixable Viability Dye eFluor 780 ThermoFisher Cat#65-0865-14 DAPI ThermoFisher Cat#D1306 7-AAD ThermoFisher Cat#A1310 SurePAGETM, Bis-Tris, 10 × 8, 4-12%, 15 wells GenScript Cat#M00654 Critical commercial assays CellTiter-Glo 2.0 Cell Viability Assay Promega Cat#G9241 2′3′-cGAMP ELISA kit Cayman Chemical Cat#501700 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 RosetteSep Human T cell Enrichment Cocktail StemCell Technologies Cat#15061 SepMate-50 PBMC isolation tubes StemCell Technologies Cat#85450 MojoSort Mouse CD4 T cell Isolation Kit BioLegend Cat#480033 MojoSort Mouse CD8 T cell Isolation Kit BioLegend Cat#480035 Direct-zol RNA MiniPrep Kit Zymo Research Cat#R2050 Maxima First Strand cDNA Synthesis Kit for RTqPCR ThermoFisher Cat#K1672 AccuPower GreenStar RT-qPCR Master Mix Bioneer Cat#K-6403 Gibson Assembly HiFi DNA Master Mix New England Biolabs Cat#E2621 QIAamp DNA Blood Maxi Kit QIAGEN Cat#51194 NextSeq 500/550 Mid Output v2 kit Illumina Cat#FC-404-2001 Deposited data Uncropped Western blot images This paper Mendeley Data: https://doi.org/10.17632/ trrgvjfbx3.2 Bulk RNA-seq: resting vs. activated human T cells This paper GEO: GSE325689 Bulk RNA-seq: SLC7A1- and SLC7A2overexpressing U937 SLC19A1− /− cells This paper GEO: GSE325690 sgRNA counts from CRISPR live/dead screen This paper Table S2 (Continued on next page) Cell Reports 45, 117580, July 28, 2026 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human immune cell transcript database (DICE) Schmiedel et al.33 https://dice-database.org/ Human T cell proteomic database Cano-Gamez et al.39 https://cytokines.cellgeni.sanger.ac.uk/ Human Protein Atlas v25.0 Jin et al.40 https://proteinatlas.org AlphaFold structure of human SLC7A1 Jumper et al.41 UniProt: P30825 AlphaFold structure of human SLC7A2 Jumper et al.41 UniProt: P52569 Geobacillus LAT crystal structure (arginine-bound) Jungnickel et al.37 PDB: 6F34 Experimental models: Cell lines Human: U937 SLC19A1− /− Ritchie et al.31 N/A Human: HEK293T ATCC Cat#CRL-3216; RRID:CVCL_0063 Human: Jurkat E6-1 ATCC Cat#TIB-152; RRID:CVCL_0367 Human: TIME (telomerase-immortalized microvascular endothelial) ATCC Cat#CRL-4025; RRID:CVCL_0047 Human: OCI-Ly7 DSMZ Cat#ACC688 Mouse: BV-2 Accegen Cat#ABC-TC212S Experimental models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory Strain#000664; RRID:IMSR_JAX:000664
Article Title: Intra-tumoral hypoxia promotes CD8 + T cell dysfunction via chronic activation of integrated stress response transcription factor ATF4.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Human pleomorphic undifferentiated high-grade deep sarcomas University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Human blood (matched to tumor) University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Chemical, peptide and recombinant proteins Recombinant human IL-2 NCI: Biological Resources Branch Ro 23-6019 GolgiPlug Protein Transport Inhibitor (Brefeldin A) BD Biosciences Cat# 51-2301KZ Cell Stimulation Cocktail ThermoFisher Cat# 00-4970-93 Pierce RIPA Buffer Thermo Scientific Cat# 89900 Protease Inhibitor Cocktail Cell Signaling Technology Cat# 5871 Phosphatase Inhibitor Cocktail I Sigma Aldrich Cat# P2850 Phosphatase Inhibitor Cocktail II Sigma Aldrich Cat# P5726 OVA peptide (OVA 257-267) InvivoGen Cat# vac-sin Geneticin Selective Antibiotic ThermoFisher Cat# 10131-035 Seahorse XF DMEM Medium, pH 7.4 Agilent Cat# 103575-100 CellTak Cell and Tissue Adhesive Corning Cat# 354240 Histopaque-1077 Sigma Aldrich Cat# 10771 N-acetyl-L-cysteine Sigma Aldrich Cat# A9165 Percoll Cytiva Cat# 17089101 Critical commercial assays UltraComp eBeads Plus Compensation Beads ThermoFisher Cat# 1333342 Foxp3/Transcription Factor Fixation/ Permeabilization Kit ThermoFisher Cat# 00-5521-00 Pierce BCA Protein Assay Kit ThermoFisher Cat# 23225 Seahorse XFe96 FluxPak Mini Agilent Technologies Cat# 102601-100 Zombie NIR Viability Stain Biolegend Cat# 420106 MitoSox Mitochondrial Superoxide Indicator ThermoFisher Cat# M36008 RNeasy RNA Isolation Kit Qiagen Cat# 74104 High Capacity RNA-to-cDNA Kit ThermoFisher Cat# 4387406 Taqman single gene expression qPCR Mastermix ThermoFisher Cat# 4440040 Mouse Tumor Dissociation Kit Miltenyi Biotec Cat# 130-096-730 Human Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 EasySep Mouse CD8 + T Cell Isolation Kit Stemcell Technologies Cat# 19853 P3 Primary Cell 4D Nucleofector X Kit S Lonza Cat# V4XP-3032 Alt-R Sp Cas9 Nuclease V3 IDT Cat# 1081059 ISRIB Sigma Aldrich Cat# SML0843 eBioscience Annexin V-FITC Apoptosis Detection Kit ThermoFisher Cat# 88-8103-72 eBioscience BrdU Staining Kit for Flow Cytometry APC ThermoFisher Cat# 8817-6600-42 GSK2606414 (PERKi) Selleckchem Cat# S7307 GCN2iB Selleckchem Cat# S8929 PKR-IN-C16 Selleckchem Cat# S9668 Mouse T cell Activator CD3/CD28 Dynabeads ThermoFisher Cat# 11452D Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat# RPN2232 OPAL 6-plex detection kit Akoya Cat# NEL8710011KT Bond dewax solution Leica Cat# AR9222 (Continued on next page) e2 Immunity 58, 1–16.e1–e8, October 14, 2025 .. E8Icre (C57BL/6-Tg(Cd8a-cre)1Itan/J), ATF4 Tg/Tg (C57BL/6;129X1-Gt(ROSA)26Sor tm2(ATF4)Myz /J), ATF4 f/f (C57BL/6-Atf4 tm1.1Cmad /J), OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J), CD45.1 (C57BL/6.SJL-Ptprc a Pepc b /BoyJ), and C57BL/6 mice were obtained from Jackson Laboratories.
Cell Isolation:Article Title: Activation-induced SLC7A1 expression enhances T cell sensitivity to cGAMP-mediated STING signaling.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Poly-D-lysine Gibco/ThermoFisher Cat#A3890401 DMEM Corning Cat#10-013-CV RPMI 1640 Corning Cat#10-040-CV IMDM Corning Cat#10-016-CV RPMI 1640 for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88365 IMDM for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88423 Vascular Cell Basal Medium ATCC Cat#PCS-100-030 Microvascular Endothelial Cell Growth Kit-VEGF ATCC Cat#PCS-110-041 Fetal bovine serum (FBS) Atlanta Biologicals Cat#S11150 Penicillin-Streptomycin (10,000 U/mL) Gibco/ThermoFisher Cat#15140122 1× RBC Lysis Buffer Invitrogen/ThermoFisher Cat#00-4333-57 FuGENE 6 transfection reagent Promega Cat#E2691 Dynabeads Human T-Activator CD3/CD28 ThermoFisher Cat#11131D Dynabeads Mouse T-Activator CD3/CD28 ThermoFisher Cat#11452D Recombinant human IL-2 PeproTech Cat#200-02 UltraComp eBeads Plus Compensation Beads ThermoFisher Cat#01-3333-41 T-PER Tissue Protein Extraction Reagent ThermoFisher Cat#78510 TRIzol Reagent ThermoFisher Cat#15596026 Laemmli Sample Buffer (4×) Bio-Rad Cat#1610747 L-[2,3,4-3H]-Arginine monohydrochloride PerkinElmer/Revvity Cat#NET1123250UC Alt-R S.p. .. Cas9 Nuclease V3 Integrated DNA Technologies Cat#1081058 P3 Primary Cell 4D-Nucleofector X Kit Lonza Cat#V4XP-3024 eBioscience Fixable Viability Dye eFluor 780 ThermoFisher Cat#65-0865-14 DAPI ThermoFisher Cat#D1306 7-AAD ThermoFisher Cat#A1310 SurePAGETM, Bis-Tris, 10 × 8, 4-12%, 15 wells GenScript Cat#M00654 Critical commercial assays CellTiter-Glo 2.0 Cell Viability Assay Promega Cat#G9241 2′3′-cGAMP ELISA kit Cayman Chemical Cat#501700 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 RosetteSep Human T cell Enrichment Cocktail StemCell Technologies Cat#15061 SepMate-50 PBMC isolation tubes StemCell Technologies Cat#85450 MojoSort Mouse CD4 T cell Isolation Kit BioLegend Cat#480033 MojoSort Mouse CD8 T cell Isolation Kit BioLegend Cat#480035 Direct-zol RNA MiniPrep Kit Zymo Research Cat#R2050 Maxima First Strand cDNA Synthesis Kit for RTqPCR ThermoFisher Cat#K1672 AccuPower GreenStar RT-qPCR Master Mix Bioneer Cat#K-6403 Gibson Assembly HiFi DNA Master Mix New England Biolabs Cat#E2621 QIAamp DNA Blood Maxi Kit QIAGEN Cat#51194 NextSeq 500/550 Mid Output v2 kit Illumina Cat#FC-404-2001 Deposited data Uncropped Western blot images This paper Mendeley Data: https://doi.org/10.17632/ trrgvjfbx3.2 Bulk RNA-seq: resting vs. activated human T cells This paper GEO: GSE325689 Bulk RNA-seq: SLC7A1- and SLC7A2overexpressing U937 SLC19A1− /− cells This paper GEO: GSE325690 sgRNA counts from CRISPR live/dead screen This paper Table S2 (Continued on next page) Cell Reports 45, 117580, July 28, 2026 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human immune cell transcript database (DICE) Schmiedel et al.33 https://dice-database.org/ Human T cell proteomic database Cano-Gamez et al.39 https://cytokines.cellgeni.sanger.ac.uk/ Human Protein Atlas v25.0 Jin et al.40 https://proteinatlas.org AlphaFold structure of human SLC7A1 Jumper et al.41 UniProt: P30825 AlphaFold structure of human SLC7A2 Jumper et al.41 UniProt: P52569 Geobacillus LAT crystal structure (arginine-bound) Jungnickel et al.37 PDB: 6F34 Experimental models: Cell lines Human: U937 SLC19A1− /− Ritchie et al.31 N/A Human: HEK293T ATCC Cat#CRL-3216; RRID:CVCL_0063 Human: Jurkat E6-1 ATCC Cat#TIB-152; RRID:CVCL_0367 Human: TIME (telomerase-immortalized microvascular endothelial) ATCC Cat#CRL-4025; RRID:CVCL_0047 Human: OCI-Ly7 DSMZ Cat#ACC688 Mouse: BV-2 Accegen Cat#ABC-TC212S Experimental models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory Strain#000664; RRID:IMSR_JAX:000664
Article Title: Glycolysis inhibition functionally reprograms T follicular helper cells and reverses lupus.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cyto-ID Autophagy Detection Kit Enzo Life Sci Cat#ENZ-51031-K200 RosetteSep CD4 + T cell enrichment cocktail Stemcell Tech. .. Cat#15062 NAD/NADH-Glo TM kit Promega Cat#G9071 RNeasy Plus Micro Kit Qiagen Cat#74034 TruSeq Stranded RNA Sample Preparation Kit Illumina Cat#20020596 AMPure XP beads Beckman Coulter Cat#A63880 Quant-iT TM PicoGreen TM dsDNA assay ThermoFisher Cat#P7589 Qick-DNA Microprep Plus kit Zymo Research Cat#D4074 Next Enzymatic Methyl-seq Kit NEB Cat#E7120 Fixation/Permeabilization kit eBioscience Cat#00-5123-43 CD4 T cell Isolation Kit Miltenyi Biotec Cat#130-104-454 B Cell Isolation Kit Miltenyi Biotec Cat#130-090-862 Pierce BCA protein assay kit ThermoFisher Cat23225 4 - 20% SDS-PAGE gels BioRad Cat#4561094 Kallestad HEp-2 BioRad Cat#26101 Deposited data Murine Tfh cell RNASeq dataset and DNA bisulfite sequencing dataset NCBI BioProject PRJNA1089578 human Tfh cell RNASeq dataset NCBI BioProject PRJNA1089580 Untargeted metabolomics analysis of murine Tfh cells National Metabolomics Data Repository ST004242 Untargeted metabolomics analysis of human Tfh cells National Metabolomics Data Repository ST004243 Experimental models: Organisms/strains B6.NZM-Sle1 NZM2410/Aeg Sle2 NZM2410/Aeg Sle3 NZM2410/Aeg /LmoJ (TC) female mice Jackson Laboratory RRID:IMSR_JAX:007228 C57BL6/J mice Jackson Laboratory RRID:IMSR_JAX:000664 NZW/J female mice Jackson Laboratory RRID:IMSR_JAX:001058 BXSB/MpJ male mice Jackson Laboratory RRID:IMSR_JAX:000740 WYaa male mice This paper B6.Cg-Sle1 NZM2410/Aeg Yaa/DcrJ Jackson Laboratory RRID:IMSR_JAX:021569 Software and algorithms FlowJo V10 Tree Star https://www.flowjo.com/solutions/flowjo/downloads Prism Graphpad https://www.graphpad.com/scientific-software/prism/ ImageJ NIH https://imagej.nih.gov/ij/ Metamorph Molecular Devices https://www.moleculardevices.com/products/ cellular-imaging-systems/high-contentanalysis/metamorph-microscopy STAR aligner v2.7 Open source https://github.com/alexdobin/STAR FeatureCounts (v2.0) Bioconductor https://subread.sourceforge.net/featureCounts.html DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html pheatmap R function (version 1.0.12) Datacamp https://www.rdocumentation.org/packages/ pheatmap/versions/1.0.12 Matplotlib-Venn (Version 0.11.5) MIT https://www.piwheels.org/project/matplotlib-venn/ Bismark v0.22.3 Babraham Institute https://www.bioinformatics.babraham.ac.uk/ projects/bismark/ DSS Ge et al. 84 https://www.bioconductor.org/packages/ release/bioc/html/DSS.html BEDTools v2.29.2 Ge et al. 84 https://bedtools.readthedocs.io/en/latest/ DAVID NCI https://david.ncifcrf.gov 20 Cell Reports 44, 116600, December 23, 2025 ..
Article Title: Intra-tumoral hypoxia promotes CD8 + T cell dysfunction via chronic activation of integrated stress response transcription factor ATF4.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Human pleomorphic undifferentiated high-grade deep sarcomas University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Human blood (matched to tumor) University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Chemical, peptide and recombinant proteins Recombinant human IL-2 NCI: Biological Resources Branch Ro 23-6019 GolgiPlug Protein Transport Inhibitor (Brefeldin A) BD Biosciences Cat# 51-2301KZ Cell Stimulation Cocktail ThermoFisher Cat# 00-4970-93 Pierce RIPA Buffer Thermo Scientific Cat# 89900 Protease Inhibitor Cocktail Cell Signaling Technology Cat# 5871 Phosphatase Inhibitor Cocktail I Sigma Aldrich Cat# P2850 Phosphatase Inhibitor Cocktail II Sigma Aldrich Cat# P5726 OVA peptide (OVA 257-267) InvivoGen Cat# vac-sin Geneticin Selective Antibiotic ThermoFisher Cat# 10131-035 Seahorse XF DMEM Medium, pH 7.4 Agilent Cat# 103575-100 CellTak Cell and Tissue Adhesive Corning Cat# 354240 Histopaque-1077 Sigma Aldrich Cat# 10771 N-acetyl-L-cysteine Sigma Aldrich Cat# A9165 Percoll Cytiva Cat# 17089101 Critical commercial assays UltraComp eBeads Plus Compensation Beads ThermoFisher Cat# 1333342 Foxp3/Transcription Factor Fixation/ Permeabilization Kit ThermoFisher Cat# 00-5521-00 Pierce BCA Protein Assay Kit ThermoFisher Cat# 23225 Seahorse XFe96 FluxPak Mini Agilent Technologies Cat# 102601-100 Zombie NIR Viability Stain Biolegend Cat# 420106 MitoSox Mitochondrial Superoxide Indicator ThermoFisher Cat# M36008 RNeasy RNA Isolation Kit Qiagen Cat# 74104 High Capacity RNA-to-cDNA Kit ThermoFisher Cat# 4387406 Taqman single gene expression qPCR Mastermix ThermoFisher Cat# 4440040 Mouse Tumor Dissociation Kit Miltenyi Biotec Cat# 130-096-730 Human Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 EasySep Mouse CD8 + T Cell Isolation Kit Stemcell Technologies Cat# 19853 P3 Primary Cell 4D Nucleofector X Kit S Lonza Cat# V4XP-3032 Alt-R Sp Cas9 Nuclease V3 IDT Cat# 1081059 ISRIB Sigma Aldrich Cat# SML0843 eBioscience Annexin V-FITC Apoptosis Detection Kit ThermoFisher Cat# 88-8103-72 eBioscience BrdU Staining Kit for Flow Cytometry APC ThermoFisher Cat# 8817-6600-42 GSK2606414 (PERKi) Selleckchem Cat# S7307 GCN2iB Selleckchem Cat# S8929 PKR-IN-C16 Selleckchem Cat# S9668 Mouse T cell Activator CD3/CD28 Dynabeads ThermoFisher Cat# 11452D Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat# RPN2232 OPAL 6-plex detection kit Akoya Cat# NEL8710011KT Bond dewax solution Leica Cat# AR9222 (Continued on next page) e2 Immunity 58, 1–16.e1–e8, October 14, 2025 .. E8Icre (C57BL/6-Tg(Cd8a-cre)1Itan/J), ATF4 Tg/Tg (C57BL/6;129X1-Gt(ROSA)26Sor tm2(ATF4)Myz /J), ATF4 f/f (C57BL/6-Atf4 tm1.1Cmad /J), OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J), CD45.1 (C57BL/6.SJL-Ptprc a Pepc b /BoyJ), and C57BL/6 mice were obtained from Jackson Laboratories.
cDNA Synthesis:Article Title: Activation-induced SLC7A1 expression enhances T cell sensitivity to cGAMP-mediated STING signaling.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Poly-D-lysine Gibco/ThermoFisher Cat#A3890401 DMEM Corning Cat#10-013-CV RPMI 1640 Corning Cat#10-040-CV IMDM Corning Cat#10-016-CV RPMI 1640 for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88365 IMDM for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88423 Vascular Cell Basal Medium ATCC Cat#PCS-100-030 Microvascular Endothelial Cell Growth Kit-VEGF ATCC Cat#PCS-110-041 Fetal bovine serum (FBS) Atlanta Biologicals Cat#S11150 Penicillin-Streptomycin (10,000 U/mL) Gibco/ThermoFisher Cat#15140122 1× RBC Lysis Buffer Invitrogen/ThermoFisher Cat#00-4333-57 FuGENE 6 transfection reagent Promega Cat#E2691 Dynabeads Human T-Activator CD3/CD28 ThermoFisher Cat#11131D Dynabeads Mouse T-Activator CD3/CD28 ThermoFisher Cat#11452D Recombinant human IL-2 PeproTech Cat#200-02 UltraComp eBeads Plus Compensation Beads ThermoFisher Cat#01-3333-41 T-PER Tissue Protein Extraction Reagent ThermoFisher Cat#78510 TRIzol Reagent ThermoFisher Cat#15596026 Laemmli Sample Buffer (4×) Bio-Rad Cat#1610747 L-[2,3,4-3H]-Arginine monohydrochloride PerkinElmer/Revvity Cat#NET1123250UC Alt-R S.p. .. Cas9 Nuclease V3 Integrated DNA Technologies Cat#1081058 P3 Primary Cell 4D-Nucleofector X Kit Lonza Cat#V4XP-3024 eBioscience Fixable Viability Dye eFluor 780 ThermoFisher Cat#65-0865-14 DAPI ThermoFisher Cat#D1306 7-AAD ThermoFisher Cat#A1310 SurePAGETM, Bis-Tris, 10 × 8, 4-12%, 15 wells GenScript Cat#M00654 Critical commercial assays CellTiter-Glo 2.0 Cell Viability Assay Promega Cat#G9241 2′3′-cGAMP ELISA kit Cayman Chemical Cat#501700 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 RosetteSep Human T cell Enrichment Cocktail StemCell Technologies Cat#15061 SepMate-50 PBMC isolation tubes StemCell Technologies Cat#85450 MojoSort Mouse CD4 T cell Isolation Kit BioLegend Cat#480033 MojoSort Mouse CD8 T cell Isolation Kit BioLegend Cat#480035 Direct-zol RNA MiniPrep Kit Zymo Research Cat#R2050 Maxima First Strand cDNA Synthesis Kit for RTqPCR ThermoFisher Cat#K1672 AccuPower GreenStar RT-qPCR Master Mix Bioneer Cat#K-6403 Gibson Assembly HiFi DNA Master Mix New England Biolabs Cat#E2621 QIAamp DNA Blood Maxi Kit QIAGEN Cat#51194 NextSeq 500/550 Mid Output v2 kit Illumina Cat#FC-404-2001 Deposited data Uncropped Western blot images This paper Mendeley Data: https://doi.org/10.17632/ trrgvjfbx3.2 Bulk RNA-seq: resting vs. activated human T cells This paper GEO: GSE325689 Bulk RNA-seq: SLC7A1- and SLC7A2overexpressing U937 SLC19A1− /− cells This paper GEO: GSE325690 sgRNA counts from CRISPR live/dead screen This paper Table S2 (Continued on next page) Cell Reports 45, 117580, July 28, 2026 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human immune cell transcript database (DICE) Schmiedel et al.33 https://dice-database.org/ Human T cell proteomic database Cano-Gamez et al.39 https://cytokines.cellgeni.sanger.ac.uk/ Human Protein Atlas v25.0 Jin et al.40 https://proteinatlas.org AlphaFold structure of human SLC7A1 Jumper et al.41 UniProt: P30825 AlphaFold structure of human SLC7A2 Jumper et al.41 UniProt: P52569 Geobacillus LAT crystal structure (arginine-bound) Jungnickel et al.37 PDB: 6F34 Experimental models: Cell lines Human: U937 SLC19A1− /− Ritchie et al.31 N/A Human: HEK293T ATCC Cat#CRL-3216; RRID:CVCL_0063 Human: Jurkat E6-1 ATCC Cat#TIB-152; RRID:CVCL_0367 Human: TIME (telomerase-immortalized microvascular endothelial) ATCC Cat#CRL-4025; RRID:CVCL_0047 Human: OCI-Ly7 DSMZ Cat#ACC688 Mouse: BV-2 Accegen Cat#ABC-TC212S Experimental models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory Strain#000664; RRID:IMSR_JAX:000664
Article Title: GPR75 in glutamatergic neurons regulates body weight.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Gpr75 Novus Biologicals Cat# NBP1-59406; RRID: AB_11037221 Opal570 Akoya Biosciences Cat# FP1488001KT; RRID: AB_3739820 Opal520 Akoya Biosciences Cat# FP1487001KT; RRID: AB_3739821 Chemicals, peptides, and recombinant proteins Alt-R TM S.p. dCas9 Protein V3 Integrated DNA Technologies Cat#1081067 Gpr75 (NINQMPIPSA(R10), AQUA QuantProHeavy ThermoFisher N/A Critical commercial assays Multiplex fluorescent kit Bio-techne Cat# 323110 Aurum TM Total RNA Fatty and Fibrous Tissue Kit Biorad Cat# 7326830 High-Capacity cDNA Synthesis Kit Applied Biosystems Cat# 43-688-14 BCA protein assay kit ThermoFisher Cat# A55864 protein A/G beads ThermoFisher Cat# 88803 Deposited data Adulescent Mouse Brain Atlas Zeisel et al. 29 http://mousebrain.org Mendeley data (raw data) This manuscript Mendeley Data: http://doi.org/10.17632/ 789hrg254v.1 Experimental models: Organisms/strains vGlut2-Cre (Slc17a6 tm2(cre)Lowl ) Vong et al. 32 Bradford Lowell vGat-Cre (B6J.129S6(FVB)-Slc32a1 tm2(cre)Lowl /MwarJ) Vong et al. 32 Bradford Lowell Cmv-Cre (B6.C-Tg(CMV-cre)1Cgn/J) Jackson Labs RRID:IMSR_JAX:006054 Gpr75 flox This manuscript N/A Gpr75 TB This manuscript N/A Oligonucleotides 5 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA CAGGAAUACGACCUCUCCAUGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A 3 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA UAGAGGAUUGUACUACAGUAGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Gpr75 TB floxed Alt-R CRISPR-Cas9 gRNA CAUUGGGGACAUUCUGAAGCGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Alt-R TM CRISPR-Cas9 tracrRNA Integrated DNA Technologies (IDT) Cat# 1072532 qPCR probes: Table S1 Life Biotechnologies N/A Genotyping primers: Table S1 Integrated DNA Technologies (IDT) N/A RNAscope Probe Gpr75 Bio-techne cat# 318281-c1 RNAscope Probe Slc17a6 Bio-techne cat#319171-c2 RNAscope Probe Gad1 Bio-techne cat#400951-C2 Software and algorithms ImageJ Schneider et al. 71 https://imagej.nih.gov/ij/ CFX maestro Software v2.3 Biorad #12013758 DIA-NN v1.8.1 Demichev et al. 72 https://aptila.bio Prism (version 10.4.0) GraphPad www.graphpad.com Other High Fat Diet Research Diets Inc D12492 12 Cell Reports 45, 117011, March 24, 2026 ..
Quantitative RT-PCR:Article Title: Activation-induced SLC7A1 expression enhances T cell sensitivity to cGAMP-mediated STING signaling.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Poly-D-lysine Gibco/ThermoFisher Cat#A3890401 DMEM Corning Cat#10-013-CV RPMI 1640 Corning Cat#10-040-CV IMDM Corning Cat#10-016-CV RPMI 1640 for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88365 IMDM for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88423 Vascular Cell Basal Medium ATCC Cat#PCS-100-030 Microvascular Endothelial Cell Growth Kit-VEGF ATCC Cat#PCS-110-041 Fetal bovine serum (FBS) Atlanta Biologicals Cat#S11150 Penicillin-Streptomycin (10,000 U/mL) Gibco/ThermoFisher Cat#15140122 1× RBC Lysis Buffer Invitrogen/ThermoFisher Cat#00-4333-57 FuGENE 6 transfection reagent Promega Cat#E2691 Dynabeads Human T-Activator CD3/CD28 ThermoFisher Cat#11131D Dynabeads Mouse T-Activator CD3/CD28 ThermoFisher Cat#11452D Recombinant human IL-2 PeproTech Cat#200-02 UltraComp eBeads Plus Compensation Beads ThermoFisher Cat#01-3333-41 T-PER Tissue Protein Extraction Reagent ThermoFisher Cat#78510 TRIzol Reagent ThermoFisher Cat#15596026 Laemmli Sample Buffer (4×) Bio-Rad Cat#1610747 L-[2,3,4-3H]-Arginine monohydrochloride PerkinElmer/Revvity Cat#NET1123250UC Alt-R S.p. .. Cas9 Nuclease V3 Integrated DNA Technologies Cat#1081058 P3 Primary Cell 4D-Nucleofector X Kit Lonza Cat#V4XP-3024 eBioscience Fixable Viability Dye eFluor 780 ThermoFisher Cat#65-0865-14 DAPI ThermoFisher Cat#D1306 7-AAD ThermoFisher Cat#A1310 SurePAGETM, Bis-Tris, 10 × 8, 4-12%, 15 wells GenScript Cat#M00654 Critical commercial assays CellTiter-Glo 2.0 Cell Viability Assay Promega Cat#G9241 2′3′-cGAMP ELISA kit Cayman Chemical Cat#501700 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 RosetteSep Human T cell Enrichment Cocktail StemCell Technologies Cat#15061 SepMate-50 PBMC isolation tubes StemCell Technologies Cat#85450 MojoSort Mouse CD4 T cell Isolation Kit BioLegend Cat#480033 MojoSort Mouse CD8 T cell Isolation Kit BioLegend Cat#480035 Direct-zol RNA MiniPrep Kit Zymo Research Cat#R2050 Maxima First Strand cDNA Synthesis Kit for RTqPCR ThermoFisher Cat#K1672 AccuPower GreenStar RT-qPCR Master Mix Bioneer Cat#K-6403 Gibson Assembly HiFi DNA Master Mix New England Biolabs Cat#E2621 QIAamp DNA Blood Maxi Kit QIAGEN Cat#51194 NextSeq 500/550 Mid Output v2 kit Illumina Cat#FC-404-2001 Deposited data Uncropped Western blot images This paper Mendeley Data: https://doi.org/10.17632/ trrgvjfbx3.2 Bulk RNA-seq: resting vs. activated human T cells This paper GEO: GSE325689 Bulk RNA-seq: SLC7A1- and SLC7A2overexpressing U937 SLC19A1− /− cells This paper GEO: GSE325690 sgRNA counts from CRISPR live/dead screen This paper Table S2 (Continued on next page) Cell Reports 45, 117580, July 28, 2026 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human immune cell transcript database (DICE) Schmiedel et al.33 https://dice-database.org/ Human T cell proteomic database Cano-Gamez et al.39 https://cytokines.cellgeni.sanger.ac.uk/ Human Protein Atlas v25.0 Jin et al.40 https://proteinatlas.org AlphaFold structure of human SLC7A1 Jumper et al.41 UniProt: P30825 AlphaFold structure of human SLC7A2 Jumper et al.41 UniProt: P52569 Geobacillus LAT crystal structure (arginine-bound) Jungnickel et al.37 PDB: 6F34 Experimental models: Cell lines Human: U937 SLC19A1− /− Ritchie et al.31 N/A Human: HEK293T ATCC Cat#CRL-3216; RRID:CVCL_0063 Human: Jurkat E6-1 ATCC Cat#TIB-152; RRID:CVCL_0367 Human: TIME (telomerase-immortalized microvascular endothelial) ATCC Cat#CRL-4025; RRID:CVCL_0047 Human: OCI-Ly7 DSMZ Cat#ACC688 Mouse: BV-2 Accegen Cat#ABC-TC212S Experimental models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory Strain#000664; RRID:IMSR_JAX:000664
CRISPR:Article Title: Activation-induced SLC7A1 expression enhances T cell sensitivity to cGAMP-mediated STING signaling.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Poly-D-lysine Gibco/ThermoFisher Cat#A3890401 DMEM Corning Cat#10-013-CV RPMI 1640 Corning Cat#10-040-CV IMDM Corning Cat#10-016-CV RPMI 1640 for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88365 IMDM for SILAC (without L-Arg, L-Lys) ThermoFisher Cat#88423 Vascular Cell Basal Medium ATCC Cat#PCS-100-030 Microvascular Endothelial Cell Growth Kit-VEGF ATCC Cat#PCS-110-041 Fetal bovine serum (FBS) Atlanta Biologicals Cat#S11150 Penicillin-Streptomycin (10,000 U/mL) Gibco/ThermoFisher Cat#15140122 1× RBC Lysis Buffer Invitrogen/ThermoFisher Cat#00-4333-57 FuGENE 6 transfection reagent Promega Cat#E2691 Dynabeads Human T-Activator CD3/CD28 ThermoFisher Cat#11131D Dynabeads Mouse T-Activator CD3/CD28 ThermoFisher Cat#11452D Recombinant human IL-2 PeproTech Cat#200-02 UltraComp eBeads Plus Compensation Beads ThermoFisher Cat#01-3333-41 T-PER Tissue Protein Extraction Reagent ThermoFisher Cat#78510 TRIzol Reagent ThermoFisher Cat#15596026 Laemmli Sample Buffer (4×) Bio-Rad Cat#1610747 L-[2,3,4-3H]-Arginine monohydrochloride PerkinElmer/Revvity Cat#NET1123250UC Alt-R S.p. .. Cas9 Nuclease V3 Integrated DNA Technologies Cat#1081058 P3 Primary Cell 4D-Nucleofector X Kit Lonza Cat#V4XP-3024 eBioscience Fixable Viability Dye eFluor 780 ThermoFisher Cat#65-0865-14 DAPI ThermoFisher Cat#D1306 7-AAD ThermoFisher Cat#A1310 SurePAGETM, Bis-Tris, 10 × 8, 4-12%, 15 wells GenScript Cat#M00654 Critical commercial assays CellTiter-Glo 2.0 Cell Viability Assay Promega Cat#G9241 2′3′-cGAMP ELISA kit Cayman Chemical Cat#501700 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 RosetteSep Human T cell Enrichment Cocktail StemCell Technologies Cat#15061 SepMate-50 PBMC isolation tubes StemCell Technologies Cat#85450 MojoSort Mouse CD4 T cell Isolation Kit BioLegend Cat#480033 MojoSort Mouse CD8 T cell Isolation Kit BioLegend Cat#480035 Direct-zol RNA MiniPrep Kit Zymo Research Cat#R2050 Maxima First Strand cDNA Synthesis Kit for RTqPCR ThermoFisher Cat#K1672 AccuPower GreenStar RT-qPCR Master Mix Bioneer Cat#K-6403 Gibson Assembly HiFi DNA Master Mix New England Biolabs Cat#E2621 QIAamp DNA Blood Maxi Kit QIAGEN Cat#51194 NextSeq 500/550 Mid Output v2 kit Illumina Cat#FC-404-2001 Deposited data Uncropped Western blot images This paper Mendeley Data: https://doi.org/10.17632/ trrgvjfbx3.2 Bulk RNA-seq: resting vs. activated human T cells This paper GEO: GSE325689 Bulk RNA-seq: SLC7A1- and SLC7A2overexpressing U937 SLC19A1− /− cells This paper GEO: GSE325690 sgRNA counts from CRISPR live/dead screen This paper Table S2 (Continued on next page) Cell Reports 45, 117580, July 28, 2026 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human immune cell transcript database (DICE) Schmiedel et al.33 https://dice-database.org/ Human T cell proteomic database Cano-Gamez et al.39 https://cytokines.cellgeni.sanger.ac.uk/ Human Protein Atlas v25.0 Jin et al.40 https://proteinatlas.org AlphaFold structure of human SLC7A1 Jumper et al.41 UniProt: P30825 AlphaFold structure of human SLC7A2 Jumper et al.41 UniProt: P52569 Geobacillus LAT crystal structure (arginine-bound) Jungnickel et al.37 PDB: 6F34 Experimental models: Cell lines Human: U937 SLC19A1− /− Ritchie et al.31 N/A Human: HEK293T ATCC Cat#CRL-3216; RRID:CVCL_0063 Human: Jurkat E6-1 ATCC Cat#TIB-152; RRID:CVCL_0367 Human: TIME (telomerase-immortalized microvascular endothelial) ATCC Cat#CRL-4025; RRID:CVCL_0047 Human: OCI-Ly7 DSMZ Cat#ACC688 Mouse: BV-2 Accegen Cat#ABC-TC212S Experimental models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory Strain#000664; RRID:IMSR_JAX:000664
Article Title: GPR75 in glutamatergic neurons regulates body weight.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Gpr75 Novus Biologicals Cat# NBP1-59406; RRID: AB_11037221 Opal570 Akoya Biosciences Cat# FP1488001KT; RRID: AB_3739820 Opal520 Akoya Biosciences Cat# FP1487001KT; RRID: AB_3739821 Chemicals, peptides, and recombinant proteins Alt-R TM S.p. dCas9 Protein V3 Integrated DNA Technologies Cat#1081067 Gpr75 (NINQMPIPSA(R10), AQUA QuantProHeavy ThermoFisher N/A Critical commercial assays Multiplex fluorescent kit Bio-techne Cat# 323110 Aurum TM Total RNA Fatty and Fibrous Tissue Kit Biorad Cat# 7326830 High-Capacity cDNA Synthesis Kit Applied Biosystems Cat# 43-688-14 BCA protein assay kit ThermoFisher Cat# A55864 protein A/G beads ThermoFisher Cat# 88803 Deposited data Adulescent Mouse Brain Atlas Zeisel et al. 29 http://mousebrain.org Mendeley data (raw data) This manuscript Mendeley Data: http://doi.org/10.17632/ 789hrg254v.1 Experimental models: Organisms/strains vGlut2-Cre (Slc17a6 tm2(cre)Lowl ) Vong et al. 32 Bradford Lowell vGat-Cre (B6J.129S6(FVB)-Slc32a1 tm2(cre)Lowl /MwarJ) Vong et al. 32 Bradford Lowell Cmv-Cre (B6.C-Tg(CMV-cre)1Cgn/J) Jackson Labs RRID:IMSR_JAX:006054 Gpr75 flox This manuscript N/A Gpr75 TB This manuscript N/A Oligonucleotides 5 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA CAGGAAUACGACCUCUCCAUGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A 3 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA UAGAGGAUUGUACUACAGUAGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Gpr75 TB floxed Alt-R CRISPR-Cas9 gRNA CAUUGGGGACAUUCUGAAGCGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Alt-R TM CRISPR-Cas9 tracrRNA Integrated DNA Technologies (IDT) Cat# 1072532 qPCR probes: Table S1 Life Biotechnologies N/A Genotyping primers: Table S1 Integrated DNA Technologies (IDT) N/A RNAscope Probe Gpr75 Bio-techne cat# 318281-c1 RNAscope Probe Slc17a6 Bio-techne cat#319171-c2 RNAscope Probe Gad1 Bio-techne cat#400951-C2 Software and algorithms ImageJ Schneider et al. 71 https://imagej.nih.gov/ij/ CFX maestro Software v2.3 Biorad #12013758 DIA-NN v1.8.1 Demichev et al. 72 https://aptila.bio Prism (version 10.4.0) GraphPad www.graphpad.com Other High Fat Diet Research Diets Inc D12492 12 Cell Reports 45, 117011, March 24, 2026 ..
Reverse Transcription:Article Title: Coxsackievirus B infection invokes unique cell-type-specific responses in primary human pancreatic islets.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TotalSeq TM -A0251 anti-human Hashtag 1 Antibody BioLegend 394601; RRID: AB_2750015 TotalSeq TM -A0252 anti-human Hashtag 2 Antibody BioLegend 394603; RRID: AB_2750016 TotalSeq TM -A0253 anti-human Hashtag 3 Antibody BioLegend 394605; RRID: AB_2750017 TotalSeq TM -A0254 anti-human Hashtag 4 Antibody BioLegend 394607; RRID: AB_2750018 TotalSeq TM -A0255 anti-human Hashtag 5 Antibody BioLegend 394609; RRID: AB_2750019 TotalSeq TM -A0256 anti-human Hashtag 6 Antibody BioLegend 394611; RRID: AB_2750020 LC3B Antibody Cell Signaling Cat#2775S; RRID: AB_915950 Anti-SQSTM1/P62 Antibody [2C11] Abcam Cat#Ab56416; RRID: AB_945626 GAPDH (14C10 Rabbit mAb Cell Signaling Cat#2118S; RRID: AB_561053 HRP-linked anti-mouse igG antibody Cell Signaling Cat#7076S; RRID: AB_330924 HRP-linked anti-rabbit igG antibody Cell Signaling Cat#7074S; RRID: AB_2099233 Bacterial and virus strains CVB3-EGFP Hubert Tse N/A One Shot TM Stb13 TM Chemically Competent cells Invitrogen Cat#C737303 Biological samples Healthy primary human islets Prodo Laboratories Inc. N/A Chemicals, peptides, and recombinant proteins CMRL 1066 Corning Cat#99-603-CV mTeSR1 Stem Cell Technologies Cat#05850 TrypLE Express Life Technologies Cat#12604039 Y-27632 Pepro Tech Cat#129382310MG hESC-qualified Corning Matrigel Matrix Corning Cat#354277 Polyinosinic-polycytidylic acid [poly(I:C)] InvivoGen Cat#tlrl-piclv 1X PBS Corning Cat#21-030-CV DNase Qiagen Cat#79254 PowerUP SYBR Green Master Mix Life Technologies Cat#A25742 XF calibrant solution Agilent Cat#100840-000 Seahorse XF RPMI Agilent Cat#103576-100 Oligomycin Sigma Cat#O4876 FCCP & rotenone Sigma Cat#R8875 Antimycin A Sigma Cat#A8674 Heat-inactivated FBS MilliporeSigma Cat#F4135 Sodium pyruvate Corning Cat#25-000-CL Polyethylenimine Max Polysciences Cat#24765-2 Lenti-X concentrator Takara Cat#631232 Lenti-X GoStix Plus Takara Cat#631280 Lysis Buffer Cell Signaling Cat#9803 Protease inhibitor Sigma Cat#118336170001 4-12% Bolt Bis-Tris Plus Mini Protein Gel ThermoFisher Cat#NW04120BOX; Cat#NW04122BOX PVDF membrane Bio-Rad Cat#1620177 Cytiva Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat#RPN2232 Critical commercial assays RNeasy Mini Kit Qiagen Cat#74106 (Continued on next page) 16 Cell Reports 44, 116211, September 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER High-Capacity cDNA Reverse Transcriptase Kit Applied Biosystems Cat#4368813 Chromium Single Cell 3 ′ V3.1 Library and Gel Bead Kit 10X Genomics Cat#PN-1000128 Dihydroethidium assay kit Abcam Cat#ab236206 QIAprep Miniprep kit Qiagen Cat#27115 Qiagen Maxi plus kit Qiagen Cat#12981 CellTiter-Fluor Cell Viability Assay Promega Cat#G6080 Caspase-Glo 3/7 Assay System Promega Cat#G8090 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 Deposited data Raw and processed scRNA-seq and bulkRNA-seq data This Paper GEO: GSE274264 Raw and processed scRNA-seq data – Human Islets Xin et al. 44 GEO: GSE114297 Raw and processed scRNA-seq data- Human Islets Maestas et al. 39 GEO: GSE237448 Experimental models: Cell lines Human: HUES8 hESC HSCI hES Cell Line: HUES-8 Oligonucleotides See Data S1 for primers used in this study This paper N/A Recombinant DNA MIR7-3HG-sh-1 (CCTTCTTCTGCAAGCTCCATT) MilliporeSigma TRCN0000172497 MIR7-3HG-sh-2 (CGAAGTTTGACGGTCTGGAAA) Millipore Sigma TRCN0000173026 pMD2.G Didier Trono Addgene #12259 psPAX2 Didier Trono Addgene #12260 Software and algorithms Seurat V4.3.0.1 Hao et al. 106 https://satijalab.org/seurat/articles/ install_v5 R V4.0.3 R https://cran.rstudio.com/bin/windows/ base/old/4.0.3/ R Studio V1.3.1093 RStudio https://posit.co/download/rstudio- desktop/ Progeny Schubert et al. 45 https://www.bioconductor.org/packages/ release/bioc/html/progeny.html#:∼:text= PROGENy%20is%20resource%20that%20 leverages%20a%20large%20compendium, of%20pathway%20responsive%20genes %20for%20human%20and%20mouse. .. Monocle 3 V1.2.9 Cao et al. 48 https://cole-trapnell-lab.github.io/monocle3/ docs/installation/ Fiji ImageJ ImageJ Public freeware https://fiji.sc/ Other V-bottom 96-well plate Corning Cat#3894 Black, clear bottom 96-well plate Costar Cat#3875 Seahorse XF24 islet Capture Microplates Agilent Cat#101122-100 OCR stats Yé pez et al. 46 https://github.com/vyepez88/OCR- Stats?tab=readme-ov-file Lenti-X 293T cells Takara Cat#632180 White, clear bottom 96-well plate Corning Cat#3903 Cell Reports 44, 116211, September 23, 2025 17
Single Cell:Article Title: Coxsackievirus B infection invokes unique cell-type-specific responses in primary human pancreatic islets.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TotalSeq TM -A0251 anti-human Hashtag 1 Antibody BioLegend 394601; RRID: AB_2750015 TotalSeq TM -A0252 anti-human Hashtag 2 Antibody BioLegend 394603; RRID: AB_2750016 TotalSeq TM -A0253 anti-human Hashtag 3 Antibody BioLegend 394605; RRID: AB_2750017 TotalSeq TM -A0254 anti-human Hashtag 4 Antibody BioLegend 394607; RRID: AB_2750018 TotalSeq TM -A0255 anti-human Hashtag 5 Antibody BioLegend 394609; RRID: AB_2750019 TotalSeq TM -A0256 anti-human Hashtag 6 Antibody BioLegend 394611; RRID: AB_2750020 LC3B Antibody Cell Signaling Cat#2775S; RRID: AB_915950 Anti-SQSTM1/P62 Antibody [2C11] Abcam Cat#Ab56416; RRID: AB_945626 GAPDH (14C10 Rabbit mAb Cell Signaling Cat#2118S; RRID: AB_561053 HRP-linked anti-mouse igG antibody Cell Signaling Cat#7076S; RRID: AB_330924 HRP-linked anti-rabbit igG antibody Cell Signaling Cat#7074S; RRID: AB_2099233 Bacterial and virus strains CVB3-EGFP Hubert Tse N/A One Shot TM Stb13 TM Chemically Competent cells Invitrogen Cat#C737303 Biological samples Healthy primary human islets Prodo Laboratories Inc. N/A Chemicals, peptides, and recombinant proteins CMRL 1066 Corning Cat#99-603-CV mTeSR1 Stem Cell Technologies Cat#05850 TrypLE Express Life Technologies Cat#12604039 Y-27632 Pepro Tech Cat#129382310MG hESC-qualified Corning Matrigel Matrix Corning Cat#354277 Polyinosinic-polycytidylic acid [poly(I:C)] InvivoGen Cat#tlrl-piclv 1X PBS Corning Cat#21-030-CV DNase Qiagen Cat#79254 PowerUP SYBR Green Master Mix Life Technologies Cat#A25742 XF calibrant solution Agilent Cat#100840-000 Seahorse XF RPMI Agilent Cat#103576-100 Oligomycin Sigma Cat#O4876 FCCP & rotenone Sigma Cat#R8875 Antimycin A Sigma Cat#A8674 Heat-inactivated FBS MilliporeSigma Cat#F4135 Sodium pyruvate Corning Cat#25-000-CL Polyethylenimine Max Polysciences Cat#24765-2 Lenti-X concentrator Takara Cat#631232 Lenti-X GoStix Plus Takara Cat#631280 Lysis Buffer Cell Signaling Cat#9803 Protease inhibitor Sigma Cat#118336170001 4-12% Bolt Bis-Tris Plus Mini Protein Gel ThermoFisher Cat#NW04120BOX; Cat#NW04122BOX PVDF membrane Bio-Rad Cat#1620177 Cytiva Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat#RPN2232 Critical commercial assays RNeasy Mini Kit Qiagen Cat#74106 (Continued on next page) 16 Cell Reports 44, 116211, September 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER High-Capacity cDNA Reverse Transcriptase Kit Applied Biosystems Cat#4368813 Chromium Single Cell 3 ′ V3.1 Library and Gel Bead Kit 10X Genomics Cat#PN-1000128 Dihydroethidium assay kit Abcam Cat#ab236206 QIAprep Miniprep kit Qiagen Cat#27115 Qiagen Maxi plus kit Qiagen Cat#12981 CellTiter-Fluor Cell Viability Assay Promega Cat#G6080 Caspase-Glo 3/7 Assay System Promega Cat#G8090 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 Deposited data Raw and processed scRNA-seq and bulkRNA-seq data This Paper GEO: GSE274264 Raw and processed scRNA-seq data – Human Islets Xin et al. 44 GEO: GSE114297 Raw and processed scRNA-seq data- Human Islets Maestas et al. 39 GEO: GSE237448 Experimental models: Cell lines Human: HUES8 hESC HSCI hES Cell Line: HUES-8 Oligonucleotides See Data S1 for primers used in this study This paper N/A Recombinant DNA MIR7-3HG-sh-1 (CCTTCTTCTGCAAGCTCCATT) MilliporeSigma TRCN0000172497 MIR7-3HG-sh-2 (CGAAGTTTGACGGTCTGGAAA) Millipore Sigma TRCN0000173026 pMD2.G Didier Trono Addgene #12259 psPAX2 Didier Trono Addgene #12260 Software and algorithms Seurat V4.3.0.1 Hao et al. 106 https://satijalab.org/seurat/articles/ install_v5 R V4.0.3 R https://cran.rstudio.com/bin/windows/ base/old/4.0.3/ R Studio V1.3.1093 RStudio https://posit.co/download/rstudio- desktop/ Progeny Schubert et al. 45 https://www.bioconductor.org/packages/ release/bioc/html/progeny.html#:∼:text= PROGENy%20is%20resource%20that%20 leverages%20a%20large%20compendium, of%20pathway%20responsive%20genes %20for%20human%20and%20mouse. .. Monocle 3 V1.2.9 Cao et al. 48 https://cole-trapnell-lab.github.io/monocle3/ docs/installation/ Fiji ImageJ ImageJ Public freeware https://fiji.sc/ Other V-bottom 96-well plate Corning Cat#3894 Black, clear bottom 96-well plate Costar Cat#3875 Seahorse XF24 islet Capture Microplates Agilent Cat#101122-100 OCR stats Yé pez et al. 46 https://github.com/vyepez88/OCR- Stats?tab=readme-ov-file Lenti-X 293T cells Takara Cat#632180 White, clear bottom 96-well plate Corning Cat#3903 Cell Reports 44, 116211, September 23, 2025 17
Caspase-Glo Assay:Article Title: Coxsackievirus B infection invokes unique cell-type-specific responses in primary human pancreatic islets.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TotalSeq TM -A0251 anti-human Hashtag 1 Antibody BioLegend 394601; RRID: AB_2750015 TotalSeq TM -A0252 anti-human Hashtag 2 Antibody BioLegend 394603; RRID: AB_2750016 TotalSeq TM -A0253 anti-human Hashtag 3 Antibody BioLegend 394605; RRID: AB_2750017 TotalSeq TM -A0254 anti-human Hashtag 4 Antibody BioLegend 394607; RRID: AB_2750018 TotalSeq TM -A0255 anti-human Hashtag 5 Antibody BioLegend 394609; RRID: AB_2750019 TotalSeq TM -A0256 anti-human Hashtag 6 Antibody BioLegend 394611; RRID: AB_2750020 LC3B Antibody Cell Signaling Cat#2775S; RRID: AB_915950 Anti-SQSTM1/P62 Antibody [2C11] Abcam Cat#Ab56416; RRID: AB_945626 GAPDH (14C10 Rabbit mAb Cell Signaling Cat#2118S; RRID: AB_561053 HRP-linked anti-mouse igG antibody Cell Signaling Cat#7076S; RRID: AB_330924 HRP-linked anti-rabbit igG antibody Cell Signaling Cat#7074S; RRID: AB_2099233 Bacterial and virus strains CVB3-EGFP Hubert Tse N/A One Shot TM Stb13 TM Chemically Competent cells Invitrogen Cat#C737303 Biological samples Healthy primary human islets Prodo Laboratories Inc. N/A Chemicals, peptides, and recombinant proteins CMRL 1066 Corning Cat#99-603-CV mTeSR1 Stem Cell Technologies Cat#05850 TrypLE Express Life Technologies Cat#12604039 Y-27632 Pepro Tech Cat#129382310MG hESC-qualified Corning Matrigel Matrix Corning Cat#354277 Polyinosinic-polycytidylic acid [poly(I:C)] InvivoGen Cat#tlrl-piclv 1X PBS Corning Cat#21-030-CV DNase Qiagen Cat#79254 PowerUP SYBR Green Master Mix Life Technologies Cat#A25742 XF calibrant solution Agilent Cat#100840-000 Seahorse XF RPMI Agilent Cat#103576-100 Oligomycin Sigma Cat#O4876 FCCP & rotenone Sigma Cat#R8875 Antimycin A Sigma Cat#A8674 Heat-inactivated FBS MilliporeSigma Cat#F4135 Sodium pyruvate Corning Cat#25-000-CL Polyethylenimine Max Polysciences Cat#24765-2 Lenti-X concentrator Takara Cat#631232 Lenti-X GoStix Plus Takara Cat#631280 Lysis Buffer Cell Signaling Cat#9803 Protease inhibitor Sigma Cat#118336170001 4-12% Bolt Bis-Tris Plus Mini Protein Gel ThermoFisher Cat#NW04120BOX; Cat#NW04122BOX PVDF membrane Bio-Rad Cat#1620177 Cytiva Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat#RPN2232 Critical commercial assays RNeasy Mini Kit Qiagen Cat#74106 (Continued on next page) 16 Cell Reports 44, 116211, September 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER High-Capacity cDNA Reverse Transcriptase Kit Applied Biosystems Cat#4368813 Chromium Single Cell 3 ′ V3.1 Library and Gel Bead Kit 10X Genomics Cat#PN-1000128 Dihydroethidium assay kit Abcam Cat#ab236206 QIAprep Miniprep kit Qiagen Cat#27115 Qiagen Maxi plus kit Qiagen Cat#12981 CellTiter-Fluor Cell Viability Assay Promega Cat#G6080 Caspase-Glo 3/7 Assay System Promega Cat#G8090 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 Deposited data Raw and processed scRNA-seq and bulkRNA-seq data This Paper GEO: GSE274264 Raw and processed scRNA-seq data – Human Islets Xin et al. 44 GEO: GSE114297 Raw and processed scRNA-seq data- Human Islets Maestas et al. 39 GEO: GSE237448 Experimental models: Cell lines Human: HUES8 hESC HSCI hES Cell Line: HUES-8 Oligonucleotides See Data S1 for primers used in this study This paper N/A Recombinant DNA MIR7-3HG-sh-1 (CCTTCTTCTGCAAGCTCCATT) MilliporeSigma TRCN0000172497 MIR7-3HG-sh-2 (CGAAGTTTGACGGTCTGGAAA) Millipore Sigma TRCN0000173026 pMD2.G Didier Trono Addgene #12259 psPAX2 Didier Trono Addgene #12260 Software and algorithms Seurat V4.3.0.1 Hao et al. 106 https://satijalab.org/seurat/articles/ install_v5 R V4.0.3 R https://cran.rstudio.com/bin/windows/ base/old/4.0.3/ R Studio V1.3.1093 RStudio https://posit.co/download/rstudio- desktop/ Progeny Schubert et al. 45 https://www.bioconductor.org/packages/ release/bioc/html/progeny.html#:∼:text= PROGENy%20is%20resource%20that%20 leverages%20a%20large%20compendium, of%20pathway%20responsive%20genes %20for%20human%20and%20mouse. .. Monocle 3 V1.2.9 Cao et al. 48 https://cole-trapnell-lab.github.io/monocle3/ docs/installation/ Fiji ImageJ ImageJ Public freeware https://fiji.sc/ Other V-bottom 96-well plate Corning Cat#3894 Black, clear bottom 96-well plate Costar Cat#3875 Seahorse XF24 islet Capture Microplates Agilent Cat#101122-100 OCR stats Yé pez et al. 46 https://github.com/vyepez88/OCR- Stats?tab=readme-ov-file Lenti-X 293T cells Takara Cat#632180 White, clear bottom 96-well plate Corning Cat#3903 Cell Reports 44, 116211, September 23, 2025 17
Software:Article Title: Coxsackievirus B infection invokes unique cell-type-specific responses in primary human pancreatic islets.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TotalSeq TM -A0251 anti-human Hashtag 1 Antibody BioLegend 394601; RRID: AB_2750015 TotalSeq TM -A0252 anti-human Hashtag 2 Antibody BioLegend 394603; RRID: AB_2750016 TotalSeq TM -A0253 anti-human Hashtag 3 Antibody BioLegend 394605; RRID: AB_2750017 TotalSeq TM -A0254 anti-human Hashtag 4 Antibody BioLegend 394607; RRID: AB_2750018 TotalSeq TM -A0255 anti-human Hashtag 5 Antibody BioLegend 394609; RRID: AB_2750019 TotalSeq TM -A0256 anti-human Hashtag 6 Antibody BioLegend 394611; RRID: AB_2750020 LC3B Antibody Cell Signaling Cat#2775S; RRID: AB_915950 Anti-SQSTM1/P62 Antibody [2C11] Abcam Cat#Ab56416; RRID: AB_945626 GAPDH (14C10 Rabbit mAb Cell Signaling Cat#2118S; RRID: AB_561053 HRP-linked anti-mouse igG antibody Cell Signaling Cat#7076S; RRID: AB_330924 HRP-linked anti-rabbit igG antibody Cell Signaling Cat#7074S; RRID: AB_2099233 Bacterial and virus strains CVB3-EGFP Hubert Tse N/A One Shot TM Stb13 TM Chemically Competent cells Invitrogen Cat#C737303 Biological samples Healthy primary human islets Prodo Laboratories Inc. N/A Chemicals, peptides, and recombinant proteins CMRL 1066 Corning Cat#99-603-CV mTeSR1 Stem Cell Technologies Cat#05850 TrypLE Express Life Technologies Cat#12604039 Y-27632 Pepro Tech Cat#129382310MG hESC-qualified Corning Matrigel Matrix Corning Cat#354277 Polyinosinic-polycytidylic acid [poly(I:C)] InvivoGen Cat#tlrl-piclv 1X PBS Corning Cat#21-030-CV DNase Qiagen Cat#79254 PowerUP SYBR Green Master Mix Life Technologies Cat#A25742 XF calibrant solution Agilent Cat#100840-000 Seahorse XF RPMI Agilent Cat#103576-100 Oligomycin Sigma Cat#O4876 FCCP & rotenone Sigma Cat#R8875 Antimycin A Sigma Cat#A8674 Heat-inactivated FBS MilliporeSigma Cat#F4135 Sodium pyruvate Corning Cat#25-000-CL Polyethylenimine Max Polysciences Cat#24765-2 Lenti-X concentrator Takara Cat#631232 Lenti-X GoStix Plus Takara Cat#631280 Lysis Buffer Cell Signaling Cat#9803 Protease inhibitor Sigma Cat#118336170001 4-12% Bolt Bis-Tris Plus Mini Protein Gel ThermoFisher Cat#NW04120BOX; Cat#NW04122BOX PVDF membrane Bio-Rad Cat#1620177 Cytiva Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat#RPN2232 Critical commercial assays RNeasy Mini Kit Qiagen Cat#74106 (Continued on next page) 16 Cell Reports 44, 116211, September 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER High-Capacity cDNA Reverse Transcriptase Kit Applied Biosystems Cat#4368813 Chromium Single Cell 3 ′ V3.1 Library and Gel Bead Kit 10X Genomics Cat#PN-1000128 Dihydroethidium assay kit Abcam Cat#ab236206 QIAprep Miniprep kit Qiagen Cat#27115 Qiagen Maxi plus kit Qiagen Cat#12981 CellTiter-Fluor Cell Viability Assay Promega Cat#G6080 Caspase-Glo 3/7 Assay System Promega Cat#G8090 Pierce BCA Protein Assay Kit ThermoFisher Cat23227 Deposited data Raw and processed scRNA-seq and bulkRNA-seq data This Paper GEO: GSE274264 Raw and processed scRNA-seq data – Human Islets Xin et al. 44 GEO: GSE114297 Raw and processed scRNA-seq data- Human Islets Maestas et al. 39 GEO: GSE237448 Experimental models: Cell lines Human: HUES8 hESC HSCI hES Cell Line: HUES-8 Oligonucleotides See Data S1 for primers used in this study This paper N/A Recombinant DNA MIR7-3HG-sh-1 (CCTTCTTCTGCAAGCTCCATT) MilliporeSigma TRCN0000172497 MIR7-3HG-sh-2 (CGAAGTTTGACGGTCTGGAAA) Millipore Sigma TRCN0000173026 pMD2.G Didier Trono Addgene #12259 psPAX2 Didier Trono Addgene #12260 Software and algorithms Seurat V4.3.0.1 Hao et al. 106 https://satijalab.org/seurat/articles/ install_v5 R V4.0.3 R https://cran.rstudio.com/bin/windows/ base/old/4.0.3/ R Studio V1.3.1093 RStudio https://posit.co/download/rstudio- desktop/ Progeny Schubert et al. 45 https://www.bioconductor.org/packages/ release/bioc/html/progeny.html#:∼:text= PROGENy%20is%20resource%20that%20 leverages%20a%20large%20compendium, of%20pathway%20responsive%20genes %20for%20human%20and%20mouse. .. Monocle 3 V1.2.9 Cao et al. 48 https://cole-trapnell-lab.github.io/monocle3/ docs/installation/ Fiji ImageJ ImageJ Public freeware https://fiji.sc/ Other V-bottom 96-well plate Corning Cat#3894 Black, clear bottom 96-well plate Costar Cat#3875 Seahorse XF24 islet Capture Microplates Agilent Cat#101122-100 OCR stats Yé pez et al. 46 https://github.com/vyepez88/OCR- Stats?tab=readme-ov-file Lenti-X 293T cells Takara Cat#632180 White, clear bottom 96-well plate Corning Cat#3903 Cell Reports 44, 116211, September 23, 2025 17
Article Title: GPR75 in glutamatergic neurons regulates body weight.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Gpr75 Novus Biologicals Cat# NBP1-59406; RRID: AB_11037221 Opal570 Akoya Biosciences Cat# FP1488001KT; RRID: AB_3739820 Opal520 Akoya Biosciences Cat# FP1487001KT; RRID: AB_3739821 Chemicals, peptides, and recombinant proteins Alt-R TM S.p. dCas9 Protein V3 Integrated DNA Technologies Cat#1081067 Gpr75 (NINQMPIPSA(R10), AQUA QuantProHeavy ThermoFisher N/A Critical commercial assays Multiplex fluorescent kit Bio-techne Cat# 323110 Aurum TM Total RNA Fatty and Fibrous Tissue Kit Biorad Cat# 7326830 High-Capacity cDNA Synthesis Kit Applied Biosystems Cat# 43-688-14 BCA protein assay kit ThermoFisher Cat# A55864 protein A/G beads ThermoFisher Cat# 88803 Deposited data Adulescent Mouse Brain Atlas Zeisel et al. 29 http://mousebrain.org Mendeley data (raw data) This manuscript Mendeley Data: http://doi.org/10.17632/ 789hrg254v.1 Experimental models: Organisms/strains vGlut2-Cre (Slc17a6 tm2(cre)Lowl ) Vong et al. 32 Bradford Lowell vGat-Cre (B6J.129S6(FVB)-Slc32a1 tm2(cre)Lowl /MwarJ) Vong et al. 32 Bradford Lowell Cmv-Cre (B6.C-Tg(CMV-cre)1Cgn/J) Jackson Labs RRID:IMSR_JAX:006054 Gpr75 flox This manuscript N/A Gpr75 TB This manuscript N/A Oligonucleotides 5 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA CAGGAAUACGACCUCUCCAUGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A 3 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA UAGAGGAUUGUACUACAGUAGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Gpr75 TB floxed Alt-R CRISPR-Cas9 gRNA CAUUGGGGACAUUCUGAAGCGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Alt-R TM CRISPR-Cas9 tracrRNA Integrated DNA Technologies (IDT) Cat# 1072532 qPCR probes: Table S1 Life Biotechnologies N/A Genotyping primers: Table S1 Integrated DNA Technologies (IDT) N/A RNAscope Probe Gpr75 Bio-techne cat# 318281-c1 RNAscope Probe Slc17a6 Bio-techne cat#319171-c2 RNAscope Probe Gad1 Bio-techne cat#400951-C2 Software and algorithms ImageJ Schneider et al. 71 https://imagej.nih.gov/ij/ CFX maestro Software v2.3 Biorad #12013758 DIA-NN v1.8.1 Demichev et al. 72 https://aptila.bio Prism (version 10.4.0) GraphPad www.graphpad.com Other High Fat Diet Research Diets Inc D12492 12 Cell Reports 45, 117011, March 24, 2026 ..
dsDNA Assay:Article Title: Glycolysis inhibition functionally reprograms T follicular helper cells and reverses lupus.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cyto-ID Autophagy Detection Kit Enzo Life Sci Cat#ENZ-51031-K200 RosetteSep CD4 + T cell enrichment cocktail Stemcell Tech. .. Cat#15062 NAD/NADH-Glo TM kit Promega Cat#G9071 RNeasy Plus Micro Kit Qiagen Cat#74034 TruSeq Stranded RNA Sample Preparation Kit Illumina Cat#20020596 AMPure XP beads Beckman Coulter Cat#A63880 Quant-iT TM PicoGreen TM dsDNA assay ThermoFisher Cat#P7589 Qick-DNA Microprep Plus kit Zymo Research Cat#D4074 Next Enzymatic Methyl-seq Kit NEB Cat#E7120 Fixation/Permeabilization kit eBioscience Cat#00-5123-43 CD4 T cell Isolation Kit Miltenyi Biotec Cat#130-104-454 B Cell Isolation Kit Miltenyi Biotec Cat#130-090-862 Pierce BCA protein assay kit ThermoFisher Cat23225 4 - 20% SDS-PAGE gels BioRad Cat#4561094 Kallestad HEp-2 BioRad Cat#26101 Deposited data Murine Tfh cell RNASeq dataset and DNA bisulfite sequencing dataset NCBI BioProject PRJNA1089578 human Tfh cell RNASeq dataset NCBI BioProject PRJNA1089580 Untargeted metabolomics analysis of murine Tfh cells National Metabolomics Data Repository ST004242 Untargeted metabolomics analysis of human Tfh cells National Metabolomics Data Repository ST004243 Experimental models: Organisms/strains B6.NZM-Sle1 NZM2410/Aeg Sle2 NZM2410/Aeg Sle3 NZM2410/Aeg /LmoJ (TC) female mice Jackson Laboratory RRID:IMSR_JAX:007228 C57BL6/J mice Jackson Laboratory RRID:IMSR_JAX:000664 NZW/J female mice Jackson Laboratory RRID:IMSR_JAX:001058 BXSB/MpJ male mice Jackson Laboratory RRID:IMSR_JAX:000740 WYaa male mice This paper B6.Cg-Sle1 NZM2410/Aeg Yaa/DcrJ Jackson Laboratory RRID:IMSR_JAX:021569 Software and algorithms FlowJo V10 Tree Star https://www.flowjo.com/solutions/flowjo/downloads Prism Graphpad https://www.graphpad.com/scientific-software/prism/ ImageJ NIH https://imagej.nih.gov/ij/ Metamorph Molecular Devices https://www.moleculardevices.com/products/ cellular-imaging-systems/high-contentanalysis/metamorph-microscopy STAR aligner v2.7 Open source https://github.com/alexdobin/STAR FeatureCounts (v2.0) Bioconductor https://subread.sourceforge.net/featureCounts.html DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html pheatmap R function (version 1.0.12) Datacamp https://www.rdocumentation.org/packages/ pheatmap/versions/1.0.12 Matplotlib-Venn (Version 0.11.5) MIT https://www.piwheels.org/project/matplotlib-venn/ Bismark v0.22.3 Babraham Institute https://www.bioinformatics.babraham.ac.uk/ projects/bismark/ DSS Ge et al. 84 https://www.bioconductor.org/packages/ release/bioc/html/DSS.html BEDTools v2.29.2 Ge et al. 84 https://bedtools.readthedocs.io/en/latest/ DAVID NCI https://david.ncifcrf.gov 20 Cell Reports 44, 116600, December 23, 2025 ..
SDS Page:Article Title: Glycolysis inhibition functionally reprograms T follicular helper cells and reverses lupus.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cyto-ID Autophagy Detection Kit Enzo Life Sci Cat#ENZ-51031-K200 RosetteSep CD4 + T cell enrichment cocktail Stemcell Tech. .. Cat#15062 NAD/NADH-Glo TM kit Promega Cat#G9071 RNeasy Plus Micro Kit Qiagen Cat#74034 TruSeq Stranded RNA Sample Preparation Kit Illumina Cat#20020596 AMPure XP beads Beckman Coulter Cat#A63880 Quant-iT TM PicoGreen TM dsDNA assay ThermoFisher Cat#P7589 Qick-DNA Microprep Plus kit Zymo Research Cat#D4074 Next Enzymatic Methyl-seq Kit NEB Cat#E7120 Fixation/Permeabilization kit eBioscience Cat#00-5123-43 CD4 T cell Isolation Kit Miltenyi Biotec Cat#130-104-454 B Cell Isolation Kit Miltenyi Biotec Cat#130-090-862 Pierce BCA protein assay kit ThermoFisher Cat23225 4 - 20% SDS-PAGE gels BioRad Cat#4561094 Kallestad HEp-2 BioRad Cat#26101 Deposited data Murine Tfh cell RNASeq dataset and DNA bisulfite sequencing dataset NCBI BioProject PRJNA1089578 human Tfh cell RNASeq dataset NCBI BioProject PRJNA1089580 Untargeted metabolomics analysis of murine Tfh cells National Metabolomics Data Repository ST004242 Untargeted metabolomics analysis of human Tfh cells National Metabolomics Data Repository ST004243 Experimental models: Organisms/strains B6.NZM-Sle1 NZM2410/Aeg Sle2 NZM2410/Aeg Sle3 NZM2410/Aeg /LmoJ (TC) female mice Jackson Laboratory RRID:IMSR_JAX:007228 C57BL6/J mice Jackson Laboratory RRID:IMSR_JAX:000664 NZW/J female mice Jackson Laboratory RRID:IMSR_JAX:001058 BXSB/MpJ male mice Jackson Laboratory RRID:IMSR_JAX:000740 WYaa male mice This paper B6.Cg-Sle1 NZM2410/Aeg Yaa/DcrJ Jackson Laboratory RRID:IMSR_JAX:021569 Software and algorithms FlowJo V10 Tree Star https://www.flowjo.com/solutions/flowjo/downloads Prism Graphpad https://www.graphpad.com/scientific-software/prism/ ImageJ NIH https://imagej.nih.gov/ij/ Metamorph Molecular Devices https://www.moleculardevices.com/products/ cellular-imaging-systems/high-contentanalysis/metamorph-microscopy STAR aligner v2.7 Open source https://github.com/alexdobin/STAR FeatureCounts (v2.0) Bioconductor https://subread.sourceforge.net/featureCounts.html DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html pheatmap R function (version 1.0.12) Datacamp https://www.rdocumentation.org/packages/ pheatmap/versions/1.0.12 Matplotlib-Venn (Version 0.11.5) MIT https://www.piwheels.org/project/matplotlib-venn/ Bismark v0.22.3 Babraham Institute https://www.bioinformatics.babraham.ac.uk/ projects/bismark/ DSS Ge et al. 84 https://www.bioconductor.org/packages/ release/bioc/html/DSS.html BEDTools v2.29.2 Ge et al. 84 https://bedtools.readthedocs.io/en/latest/ DAVID NCI https://david.ncifcrf.gov 20 Cell Reports 44, 116600, December 23, 2025 ..
RNA sequencing:Article Title: Glycolysis inhibition functionally reprograms T follicular helper cells and reverses lupus.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cyto-ID Autophagy Detection Kit Enzo Life Sci Cat#ENZ-51031-K200 RosetteSep CD4 + T cell enrichment cocktail Stemcell Tech. .. Cat#15062 NAD/NADH-Glo TM kit Promega Cat#G9071 RNeasy Plus Micro Kit Qiagen Cat#74034 TruSeq Stranded RNA Sample Preparation Kit Illumina Cat#20020596 AMPure XP beads Beckman Coulter Cat#A63880 Quant-iT TM PicoGreen TM dsDNA assay ThermoFisher Cat#P7589 Qick-DNA Microprep Plus kit Zymo Research Cat#D4074 Next Enzymatic Methyl-seq Kit NEB Cat#E7120 Fixation/Permeabilization kit eBioscience Cat#00-5123-43 CD4 T cell Isolation Kit Miltenyi Biotec Cat#130-104-454 B Cell Isolation Kit Miltenyi Biotec Cat#130-090-862 Pierce BCA protein assay kit ThermoFisher Cat23225 4 - 20% SDS-PAGE gels BioRad Cat#4561094 Kallestad HEp-2 BioRad Cat#26101 Deposited data Murine Tfh cell RNASeq dataset and DNA bisulfite sequencing dataset NCBI BioProject PRJNA1089578 human Tfh cell RNASeq dataset NCBI BioProject PRJNA1089580 Untargeted metabolomics analysis of murine Tfh cells National Metabolomics Data Repository ST004242 Untargeted metabolomics analysis of human Tfh cells National Metabolomics Data Repository ST004243 Experimental models: Organisms/strains B6.NZM-Sle1 NZM2410/Aeg Sle2 NZM2410/Aeg Sle3 NZM2410/Aeg /LmoJ (TC) female mice Jackson Laboratory RRID:IMSR_JAX:007228 C57BL6/J mice Jackson Laboratory RRID:IMSR_JAX:000664 NZW/J female mice Jackson Laboratory RRID:IMSR_JAX:001058 BXSB/MpJ male mice Jackson Laboratory RRID:IMSR_JAX:000740 WYaa male mice This paper B6.Cg-Sle1 NZM2410/Aeg Yaa/DcrJ Jackson Laboratory RRID:IMSR_JAX:021569 Software and algorithms FlowJo V10 Tree Star https://www.flowjo.com/solutions/flowjo/downloads Prism Graphpad https://www.graphpad.com/scientific-software/prism/ ImageJ NIH https://imagej.nih.gov/ij/ Metamorph Molecular Devices https://www.moleculardevices.com/products/ cellular-imaging-systems/high-contentanalysis/metamorph-microscopy STAR aligner v2.7 Open source https://github.com/alexdobin/STAR FeatureCounts (v2.0) Bioconductor https://subread.sourceforge.net/featureCounts.html DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html pheatmap R function (version 1.0.12) Datacamp https://www.rdocumentation.org/packages/ pheatmap/versions/1.0.12 Matplotlib-Venn (Version 0.11.5) MIT https://www.piwheels.org/project/matplotlib-venn/ Bismark v0.22.3 Babraham Institute https://www.bioinformatics.babraham.ac.uk/ projects/bismark/ DSS Ge et al. 84 https://www.bioconductor.org/packages/ release/bioc/html/DSS.html BEDTools v2.29.2 Ge et al. 84 https://bedtools.readthedocs.io/en/latest/ DAVID NCI https://david.ncifcrf.gov 20 Cell Reports 44, 116600, December 23, 2025 ..
Methylation Sequencing:Article Title: Glycolysis inhibition functionally reprograms T follicular helper cells and reverses lupus.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cyto-ID Autophagy Detection Kit Enzo Life Sci Cat#ENZ-51031-K200 RosetteSep CD4 + T cell enrichment cocktail Stemcell Tech. .. Cat#15062 NAD/NADH-Glo TM kit Promega Cat#G9071 RNeasy Plus Micro Kit Qiagen Cat#74034 TruSeq Stranded RNA Sample Preparation Kit Illumina Cat#20020596 AMPure XP beads Beckman Coulter Cat#A63880 Quant-iT TM PicoGreen TM dsDNA assay ThermoFisher Cat#P7589 Qick-DNA Microprep Plus kit Zymo Research Cat#D4074 Next Enzymatic Methyl-seq Kit NEB Cat#E7120 Fixation/Permeabilization kit eBioscience Cat#00-5123-43 CD4 T cell Isolation Kit Miltenyi Biotec Cat#130-104-454 B Cell Isolation Kit Miltenyi Biotec Cat#130-090-862 Pierce BCA protein assay kit ThermoFisher Cat23225 4 - 20% SDS-PAGE gels BioRad Cat#4561094 Kallestad HEp-2 BioRad Cat#26101 Deposited data Murine Tfh cell RNASeq dataset and DNA bisulfite sequencing dataset NCBI BioProject PRJNA1089578 human Tfh cell RNASeq dataset NCBI BioProject PRJNA1089580 Untargeted metabolomics analysis of murine Tfh cells National Metabolomics Data Repository ST004242 Untargeted metabolomics analysis of human Tfh cells National Metabolomics Data Repository ST004243 Experimental models: Organisms/strains B6.NZM-Sle1 NZM2410/Aeg Sle2 NZM2410/Aeg Sle3 NZM2410/Aeg /LmoJ (TC) female mice Jackson Laboratory RRID:IMSR_JAX:007228 C57BL6/J mice Jackson Laboratory RRID:IMSR_JAX:000664 NZW/J female mice Jackson Laboratory RRID:IMSR_JAX:001058 BXSB/MpJ male mice Jackson Laboratory RRID:IMSR_JAX:000740 WYaa male mice This paper B6.Cg-Sle1 NZM2410/Aeg Yaa/DcrJ Jackson Laboratory RRID:IMSR_JAX:021569 Software and algorithms FlowJo V10 Tree Star https://www.flowjo.com/solutions/flowjo/downloads Prism Graphpad https://www.graphpad.com/scientific-software/prism/ ImageJ NIH https://imagej.nih.gov/ij/ Metamorph Molecular Devices https://www.moleculardevices.com/products/ cellular-imaging-systems/high-contentanalysis/metamorph-microscopy STAR aligner v2.7 Open source https://github.com/alexdobin/STAR FeatureCounts (v2.0) Bioconductor https://subread.sourceforge.net/featureCounts.html DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html pheatmap R function (version 1.0.12) Datacamp https://www.rdocumentation.org/packages/ pheatmap/versions/1.0.12 Matplotlib-Venn (Version 0.11.5) MIT https://www.piwheels.org/project/matplotlib-venn/ Bismark v0.22.3 Babraham Institute https://www.bioinformatics.babraham.ac.uk/ projects/bismark/ DSS Ge et al. 84 https://www.bioconductor.org/packages/ release/bioc/html/DSS.html BEDTools v2.29.2 Ge et al. 84 https://bedtools.readthedocs.io/en/latest/ DAVID NCI https://david.ncifcrf.gov 20 Cell Reports 44, 116600, December 23, 2025 ..
Multiplex Assay:Article Title: GPR75 in glutamatergic neurons regulates body weight.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Gpr75 Novus Biologicals Cat# NBP1-59406; RRID: AB_11037221 Opal570 Akoya Biosciences Cat# FP1488001KT; RRID: AB_3739820 Opal520 Akoya Biosciences Cat# FP1487001KT; RRID: AB_3739821 Chemicals, peptides, and recombinant proteins Alt-R TM S.p. dCas9 Protein V3 Integrated DNA Technologies Cat#1081067 Gpr75 (NINQMPIPSA(R10), AQUA QuantProHeavy ThermoFisher N/A Critical commercial assays Multiplex fluorescent kit Bio-techne Cat# 323110 Aurum TM Total RNA Fatty and Fibrous Tissue Kit Biorad Cat# 7326830 High-Capacity cDNA Synthesis Kit Applied Biosystems Cat# 43-688-14 BCA protein assay kit ThermoFisher Cat# A55864 protein A/G beads ThermoFisher Cat# 88803 Deposited data Adulescent Mouse Brain Atlas Zeisel et al. 29 http://mousebrain.org Mendeley data (raw data) This manuscript Mendeley Data: http://doi.org/10.17632/ 789hrg254v.1 Experimental models: Organisms/strains vGlut2-Cre (Slc17a6 tm2(cre)Lowl ) Vong et al. 32 Bradford Lowell vGat-Cre (B6J.129S6(FVB)-Slc32a1 tm2(cre)Lowl /MwarJ) Vong et al. 32 Bradford Lowell Cmv-Cre (B6.C-Tg(CMV-cre)1Cgn/J) Jackson Labs RRID:IMSR_JAX:006054 Gpr75 flox This manuscript N/A Gpr75 TB This manuscript N/A Oligonucleotides 5 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA CAGGAAUACGACCUCUCCAUGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A 3 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA UAGAGGAUUGUACUACAGUAGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Gpr75 TB floxed Alt-R CRISPR-Cas9 gRNA CAUUGGGGACAUUCUGAAGCGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Alt-R TM CRISPR-Cas9 tracrRNA Integrated DNA Technologies (IDT) Cat# 1072532 qPCR probes: Table S1 Life Biotechnologies N/A Genotyping primers: Table S1 Integrated DNA Technologies (IDT) N/A RNAscope Probe Gpr75 Bio-techne cat# 318281-c1 RNAscope Probe Slc17a6 Bio-techne cat#319171-c2 RNAscope Probe Gad1 Bio-techne cat#400951-C2 Software and algorithms ImageJ Schneider et al. 71 https://imagej.nih.gov/ij/ CFX maestro Software v2.3 Biorad #12013758 DIA-NN v1.8.1 Demichev et al. 72 https://aptila.bio Prism (version 10.4.0) GraphPad www.graphpad.com Other High Fat Diet Research Diets Inc D12492 12 Cell Reports 45, 117011, March 24, 2026 ..
RNAscope:Article Title: GPR75 in glutamatergic neurons regulates body weight.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Gpr75 Novus Biologicals Cat# NBP1-59406; RRID: AB_11037221 Opal570 Akoya Biosciences Cat# FP1488001KT; RRID: AB_3739820 Opal520 Akoya Biosciences Cat# FP1487001KT; RRID: AB_3739821 Chemicals, peptides, and recombinant proteins Alt-R TM S.p. dCas9 Protein V3 Integrated DNA Technologies Cat#1081067 Gpr75 (NINQMPIPSA(R10), AQUA QuantProHeavy ThermoFisher N/A Critical commercial assays Multiplex fluorescent kit Bio-techne Cat# 323110 Aurum TM Total RNA Fatty and Fibrous Tissue Kit Biorad Cat# 7326830 High-Capacity cDNA Synthesis Kit Applied Biosystems Cat# 43-688-14 BCA protein assay kit ThermoFisher Cat# A55864 protein A/G beads ThermoFisher Cat# 88803 Deposited data Adulescent Mouse Brain Atlas Zeisel et al. 29 http://mousebrain.org Mendeley data (raw data) This manuscript Mendeley Data: http://doi.org/10.17632/ 789hrg254v.1 Experimental models: Organisms/strains vGlut2-Cre (Slc17a6 tm2(cre)Lowl ) Vong et al. 32 Bradford Lowell vGat-Cre (B6J.129S6(FVB)-Slc32a1 tm2(cre)Lowl /MwarJ) Vong et al. 32 Bradford Lowell Cmv-Cre (B6.C-Tg(CMV-cre)1Cgn/J) Jackson Labs RRID:IMSR_JAX:006054 Gpr75 flox This manuscript N/A Gpr75 TB This manuscript N/A Oligonucleotides 5 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA CAGGAAUACGACCUCUCCAUGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A 3 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA UAGAGGAUUGUACUACAGUAGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Gpr75 TB floxed Alt-R CRISPR-Cas9 gRNA CAUUGGGGACAUUCUGAAGCGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Alt-R TM CRISPR-Cas9 tracrRNA Integrated DNA Technologies (IDT) Cat# 1072532 qPCR probes: Table S1 Life Biotechnologies N/A Genotyping primers: Table S1 Integrated DNA Technologies (IDT) N/A RNAscope Probe Gpr75 Bio-techne cat# 318281-c1 RNAscope Probe Slc17a6 Bio-techne cat#319171-c2 RNAscope Probe Gad1 Bio-techne cat#400951-C2 Software and algorithms ImageJ Schneider et al. 71 https://imagej.nih.gov/ij/ CFX maestro Software v2.3 Biorad #12013758 DIA-NN v1.8.1 Demichev et al. 72 https://aptila.bio Prism (version 10.4.0) GraphPad www.graphpad.com Other High Fat Diet Research Diets Inc D12492 12 Cell Reports 45, 117011, March 24, 2026 ..
Maestro Software:Article Title: GPR75 in glutamatergic neurons regulates body weight.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Gpr75 Novus Biologicals Cat# NBP1-59406; RRID: AB_11037221 Opal570 Akoya Biosciences Cat# FP1488001KT; RRID: AB_3739820 Opal520 Akoya Biosciences Cat# FP1487001KT; RRID: AB_3739821 Chemicals, peptides, and recombinant proteins Alt-R TM S.p. dCas9 Protein V3 Integrated DNA Technologies Cat#1081067 Gpr75 (NINQMPIPSA(R10), AQUA QuantProHeavy ThermoFisher N/A Critical commercial assays Multiplex fluorescent kit Bio-techne Cat# 323110 Aurum TM Total RNA Fatty and Fibrous Tissue Kit Biorad Cat# 7326830 High-Capacity cDNA Synthesis Kit Applied Biosystems Cat# 43-688-14 BCA protein assay kit ThermoFisher Cat# A55864 protein A/G beads ThermoFisher Cat# 88803 Deposited data Adulescent Mouse Brain Atlas Zeisel et al. 29 http://mousebrain.org Mendeley data (raw data) This manuscript Mendeley Data: http://doi.org/10.17632/ 789hrg254v.1 Experimental models: Organisms/strains vGlut2-Cre (Slc17a6 tm2(cre)Lowl ) Vong et al. 32 Bradford Lowell vGat-Cre (B6J.129S6(FVB)-Slc32a1 tm2(cre)Lowl /MwarJ) Vong et al. 32 Bradford Lowell Cmv-Cre (B6.C-Tg(CMV-cre)1Cgn/J) Jackson Labs RRID:IMSR_JAX:006054 Gpr75 flox This manuscript N/A Gpr75 TB This manuscript N/A Oligonucleotides 5 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA CAGGAAUACGACCUCUCCAUGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A 3 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA UAGAGGAUUGUACUACAGUAGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Gpr75 TB floxed Alt-R CRISPR-Cas9 gRNA CAUUGGGGACAUUCUGAAGCGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Alt-R TM CRISPR-Cas9 tracrRNA Integrated DNA Technologies (IDT) Cat# 1072532 qPCR probes: Table S1 Life Biotechnologies N/A Genotyping primers: Table S1 Integrated DNA Technologies (IDT) N/A RNAscope Probe Gpr75 Bio-techne cat# 318281-c1 RNAscope Probe Slc17a6 Bio-techne cat#319171-c2 RNAscope Probe Gad1 Bio-techne cat#400951-C2 Software and algorithms ImageJ Schneider et al. 71 https://imagej.nih.gov/ij/ CFX maestro Software v2.3 Biorad #12013758 DIA-NN v1.8.1 Demichev et al. 72 https://aptila.bio Prism (version 10.4.0) GraphPad www.graphpad.com Other High Fat Diet Research Diets Inc D12492 12 Cell Reports 45, 117011, March 24, 2026 ..
Data-independent acquisition:Article Title: GPR75 in glutamatergic neurons regulates body weight.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Gpr75 Novus Biologicals Cat# NBP1-59406; RRID: AB_11037221 Opal570 Akoya Biosciences Cat# FP1488001KT; RRID: AB_3739820 Opal520 Akoya Biosciences Cat# FP1487001KT; RRID: AB_3739821 Chemicals, peptides, and recombinant proteins Alt-R TM S.p. dCas9 Protein V3 Integrated DNA Technologies Cat#1081067 Gpr75 (NINQMPIPSA(R10), AQUA QuantProHeavy ThermoFisher N/A Critical commercial assays Multiplex fluorescent kit Bio-techne Cat# 323110 Aurum TM Total RNA Fatty and Fibrous Tissue Kit Biorad Cat# 7326830 High-Capacity cDNA Synthesis Kit Applied Biosystems Cat# 43-688-14 BCA protein assay kit ThermoFisher Cat# A55864 protein A/G beads ThermoFisher Cat# 88803 Deposited data Adulescent Mouse Brain Atlas Zeisel et al. 29 http://mousebrain.org Mendeley data (raw data) This manuscript Mendeley Data: http://doi.org/10.17632/ 789hrg254v.1 Experimental models: Organisms/strains vGlut2-Cre (Slc17a6 tm2(cre)Lowl ) Vong et al. 32 Bradford Lowell vGat-Cre (B6J.129S6(FVB)-Slc32a1 tm2(cre)Lowl /MwarJ) Vong et al. 32 Bradford Lowell Cmv-Cre (B6.C-Tg(CMV-cre)1Cgn/J) Jackson Labs RRID:IMSR_JAX:006054 Gpr75 flox This manuscript N/A Gpr75 TB This manuscript N/A Oligonucleotides 5 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA CAGGAAUACGACCUCUCCAUGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A 3 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA UAGAGGAUUGUACUACAGUAGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Gpr75 TB floxed Alt-R CRISPR-Cas9 gRNA CAUUGGGGACAUUCUGAAGCGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Alt-R TM CRISPR-Cas9 tracrRNA Integrated DNA Technologies (IDT) Cat# 1072532 qPCR probes: Table S1 Life Biotechnologies N/A Genotyping primers: Table S1 Integrated DNA Technologies (IDT) N/A RNAscope Probe Gpr75 Bio-techne cat# 318281-c1 RNAscope Probe Slc17a6 Bio-techne cat#319171-c2 RNAscope Probe Gad1 Bio-techne cat#400951-C2 Software and algorithms ImageJ Schneider et al. 71 https://imagej.nih.gov/ij/ CFX maestro Software v2.3 Biorad #12013758 DIA-NN v1.8.1 Demichev et al. 72 https://aptila.bio Prism (version 10.4.0) GraphPad www.graphpad.com Other High Fat Diet Research Diets Inc D12492 12 Cell Reports 45, 117011, March 24, 2026 ..
Fat:Article Title: GPR75 in glutamatergic neurons regulates body weight.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Gpr75 Novus Biologicals Cat# NBP1-59406; RRID: AB_11037221 Opal570 Akoya Biosciences Cat# FP1488001KT; RRID: AB_3739820 Opal520 Akoya Biosciences Cat# FP1487001KT; RRID: AB_3739821 Chemicals, peptides, and recombinant proteins Alt-R TM S.p. dCas9 Protein V3 Integrated DNA Technologies Cat#1081067 Gpr75 (NINQMPIPSA(R10), AQUA QuantProHeavy ThermoFisher N/A Critical commercial assays Multiplex fluorescent kit Bio-techne Cat# 323110 Aurum TM Total RNA Fatty and Fibrous Tissue Kit Biorad Cat# 7326830 High-Capacity cDNA Synthesis Kit Applied Biosystems Cat# 43-688-14 BCA protein assay kit ThermoFisher Cat# A55864 protein A/G beads ThermoFisher Cat# 88803 Deposited data Adulescent Mouse Brain Atlas Zeisel et al. 29 http://mousebrain.org Mendeley data (raw data) This manuscript Mendeley Data: http://doi.org/10.17632/ 789hrg254v.1 Experimental models: Organisms/strains vGlut2-Cre (Slc17a6 tm2(cre)Lowl ) Vong et al. 32 Bradford Lowell vGat-Cre (B6J.129S6(FVB)-Slc32a1 tm2(cre)Lowl /MwarJ) Vong et al. 32 Bradford Lowell Cmv-Cre (B6.C-Tg(CMV-cre)1Cgn/J) Jackson Labs RRID:IMSR_JAX:006054 Gpr75 flox This manuscript N/A Gpr75 TB This manuscript N/A Oligonucleotides 5 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA CAGGAAUACGACCUCUCCAUGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A 3 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA UAGAGGAUUGUACUACAGUAGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Gpr75 TB floxed Alt-R CRISPR-Cas9 gRNA CAUUGGGGACAUUCUGAAGCGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Alt-R TM CRISPR-Cas9 tracrRNA Integrated DNA Technologies (IDT) Cat# 1072532 qPCR probes: Table S1 Life Biotechnologies N/A Genotyping primers: Table S1 Integrated DNA Technologies (IDT) N/A RNAscope Probe Gpr75 Bio-techne cat# 318281-c1 RNAscope Probe Slc17a6 Bio-techne cat#319171-c2 RNAscope Probe Gad1 Bio-techne cat#400951-C2 Software and algorithms ImageJ Schneider et al. 71 https://imagej.nih.gov/ij/ CFX maestro Software v2.3 Biorad #12013758 DIA-NN v1.8.1 Demichev et al. 72 https://aptila.bio Prism (version 10.4.0) GraphPad www.graphpad.com Other High Fat Diet Research Diets Inc D12492 12 Cell Reports 45, 117011, March 24, 2026 ..
Cell Stimulation:Article Title: Intra-tumoral hypoxia promotes CD8 + T cell dysfunction via chronic activation of integrated stress response transcription factor ATF4.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Human pleomorphic undifferentiated high-grade deep sarcomas University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Human blood (matched to tumor) University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Chemical, peptide and recombinant proteins Recombinant human IL-2 NCI: Biological Resources Branch Ro 23-6019 GolgiPlug Protein Transport Inhibitor (Brefeldin A) BD Biosciences Cat# 51-2301KZ Cell Stimulation Cocktail ThermoFisher Cat# 00-4970-93 Pierce RIPA Buffer Thermo Scientific Cat# 89900 Protease Inhibitor Cocktail Cell Signaling Technology Cat# 5871 Phosphatase Inhibitor Cocktail I Sigma Aldrich Cat# P2850 Phosphatase Inhibitor Cocktail II Sigma Aldrich Cat# P5726 OVA peptide (OVA 257-267) InvivoGen Cat# vac-sin Geneticin Selective Antibiotic ThermoFisher Cat# 10131-035 Seahorse XF DMEM Medium, pH 7.4 Agilent Cat# 103575-100 CellTak Cell and Tissue Adhesive Corning Cat# 354240 Histopaque-1077 Sigma Aldrich Cat# 10771 N-acetyl-L-cysteine Sigma Aldrich Cat# A9165 Percoll Cytiva Cat# 17089101 Critical commercial assays UltraComp eBeads Plus Compensation Beads ThermoFisher Cat# 1333342 Foxp3/Transcription Factor Fixation/ Permeabilization Kit ThermoFisher Cat# 00-5521-00 Pierce BCA Protein Assay Kit ThermoFisher Cat# 23225 Seahorse XFe96 FluxPak Mini Agilent Technologies Cat# 102601-100 Zombie NIR Viability Stain Biolegend Cat# 420106 MitoSox Mitochondrial Superoxide Indicator ThermoFisher Cat# M36008 RNeasy RNA Isolation Kit Qiagen Cat# 74104 High Capacity RNA-to-cDNA Kit ThermoFisher Cat# 4387406 Taqman single gene expression qPCR Mastermix ThermoFisher Cat# 4440040 Mouse Tumor Dissociation Kit Miltenyi Biotec Cat# 130-096-730 Human Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 EasySep Mouse CD8 + T Cell Isolation Kit Stemcell Technologies Cat# 19853 P3 Primary Cell 4D Nucleofector X Kit S Lonza Cat# V4XP-3032 Alt-R Sp Cas9 Nuclease V3 IDT Cat# 1081059 ISRIB Sigma Aldrich Cat# SML0843 eBioscience Annexin V-FITC Apoptosis Detection Kit ThermoFisher Cat# 88-8103-72 eBioscience BrdU Staining Kit for Flow Cytometry APC ThermoFisher Cat# 8817-6600-42 GSK2606414 (PERKi) Selleckchem Cat# S7307 GCN2iB Selleckchem Cat# S8929 PKR-IN-C16 Selleckchem Cat# S9668 Mouse T cell Activator CD3/CD28 Dynabeads ThermoFisher Cat# 11452D Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat# RPN2232 OPAL 6-plex detection kit Akoya Cat# NEL8710011KT Bond dewax solution Leica Cat# AR9222 (Continued on next page) e2 Immunity 58, 1–16.e1–e8, October 14, 2025 .. E8Icre (C57BL/6-Tg(Cd8a-cre)1Itan/J), ATF4 Tg/Tg (C57BL/6;129X1-Gt(ROSA)26Sor tm2(ATF4)Myz /J), ATF4 f/f (C57BL/6-Atf4 tm1.1Cmad /J), OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J), CD45.1 (C57BL/6.SJL-Ptprc a Pepc b /BoyJ), and C57BL/6 mice were obtained from Jackson Laboratories.
Adhesive:Article Title: Intra-tumoral hypoxia promotes CD8 + T cell dysfunction via chronic activation of integrated stress response transcription factor ATF4.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Human pleomorphic undifferentiated high-grade deep sarcomas University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Human blood (matched to tumor) University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Chemical, peptide and recombinant proteins Recombinant human IL-2 NCI: Biological Resources Branch Ro 23-6019 GolgiPlug Protein Transport Inhibitor (Brefeldin A) BD Biosciences Cat# 51-2301KZ Cell Stimulation Cocktail ThermoFisher Cat# 00-4970-93 Pierce RIPA Buffer Thermo Scientific Cat# 89900 Protease Inhibitor Cocktail Cell Signaling Technology Cat# 5871 Phosphatase Inhibitor Cocktail I Sigma Aldrich Cat# P2850 Phosphatase Inhibitor Cocktail II Sigma Aldrich Cat# P5726 OVA peptide (OVA 257-267) InvivoGen Cat# vac-sin Geneticin Selective Antibiotic ThermoFisher Cat# 10131-035 Seahorse XF DMEM Medium, pH 7.4 Agilent Cat# 103575-100 CellTak Cell and Tissue Adhesive Corning Cat# 354240 Histopaque-1077 Sigma Aldrich Cat# 10771 N-acetyl-L-cysteine Sigma Aldrich Cat# A9165 Percoll Cytiva Cat# 17089101 Critical commercial assays UltraComp eBeads Plus Compensation Beads ThermoFisher Cat# 1333342 Foxp3/Transcription Factor Fixation/ Permeabilization Kit ThermoFisher Cat# 00-5521-00 Pierce BCA Protein Assay Kit ThermoFisher Cat# 23225 Seahorse XFe96 FluxPak Mini Agilent Technologies Cat# 102601-100 Zombie NIR Viability Stain Biolegend Cat# 420106 MitoSox Mitochondrial Superoxide Indicator ThermoFisher Cat# M36008 RNeasy RNA Isolation Kit Qiagen Cat# 74104 High Capacity RNA-to-cDNA Kit ThermoFisher Cat# 4387406 Taqman single gene expression qPCR Mastermix ThermoFisher Cat# 4440040 Mouse Tumor Dissociation Kit Miltenyi Biotec Cat# 130-096-730 Human Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 EasySep Mouse CD8 + T Cell Isolation Kit Stemcell Technologies Cat# 19853 P3 Primary Cell 4D Nucleofector X Kit S Lonza Cat# V4XP-3032 Alt-R Sp Cas9 Nuclease V3 IDT Cat# 1081059 ISRIB Sigma Aldrich Cat# SML0843 eBioscience Annexin V-FITC Apoptosis Detection Kit ThermoFisher Cat# 88-8103-72 eBioscience BrdU Staining Kit for Flow Cytometry APC ThermoFisher Cat# 8817-6600-42 GSK2606414 (PERKi) Selleckchem Cat# S7307 GCN2iB Selleckchem Cat# S8929 PKR-IN-C16 Selleckchem Cat# S9668 Mouse T cell Activator CD3/CD28 Dynabeads ThermoFisher Cat# 11452D Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat# RPN2232 OPAL 6-plex detection kit Akoya Cat# NEL8710011KT Bond dewax solution Leica Cat# AR9222 (Continued on next page) e2 Immunity 58, 1–16.e1–e8, October 14, 2025 .. E8Icre (C57BL/6-Tg(Cd8a-cre)1Itan/J), ATF4 Tg/Tg (C57BL/6;129X1-Gt(ROSA)26Sor tm2(ATF4)Myz /J), ATF4 f/f (C57BL/6-Atf4 tm1.1Cmad /J), OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J), CD45.1 (C57BL/6.SJL-Ptprc a Pepc b /BoyJ), and C57BL/6 mice were obtained from Jackson Laboratories.
Staining:Article Title: Intra-tumoral hypoxia promotes CD8 + T cell dysfunction via chronic activation of integrated stress response transcription factor ATF4.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Human pleomorphic undifferentiated high-grade deep sarcomas University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Human blood (matched to tumor) University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Chemical, peptide and recombinant proteins Recombinant human IL-2 NCI: Biological Resources Branch Ro 23-6019 GolgiPlug Protein Transport Inhibitor (Brefeldin A) BD Biosciences Cat# 51-2301KZ Cell Stimulation Cocktail ThermoFisher Cat# 00-4970-93 Pierce RIPA Buffer Thermo Scientific Cat# 89900 Protease Inhibitor Cocktail Cell Signaling Technology Cat# 5871 Phosphatase Inhibitor Cocktail I Sigma Aldrich Cat# P2850 Phosphatase Inhibitor Cocktail II Sigma Aldrich Cat# P5726 OVA peptide (OVA 257-267) InvivoGen Cat# vac-sin Geneticin Selective Antibiotic ThermoFisher Cat# 10131-035 Seahorse XF DMEM Medium, pH 7.4 Agilent Cat# 103575-100 CellTak Cell and Tissue Adhesive Corning Cat# 354240 Histopaque-1077 Sigma Aldrich Cat# 10771 N-acetyl-L-cysteine Sigma Aldrich Cat# A9165 Percoll Cytiva Cat# 17089101 Critical commercial assays UltraComp eBeads Plus Compensation Beads ThermoFisher Cat# 1333342 Foxp3/Transcription Factor Fixation/ Permeabilization Kit ThermoFisher Cat# 00-5521-00 Pierce BCA Protein Assay Kit ThermoFisher Cat# 23225 Seahorse XFe96 FluxPak Mini Agilent Technologies Cat# 102601-100 Zombie NIR Viability Stain Biolegend Cat# 420106 MitoSox Mitochondrial Superoxide Indicator ThermoFisher Cat# M36008 RNeasy RNA Isolation Kit Qiagen Cat# 74104 High Capacity RNA-to-cDNA Kit ThermoFisher Cat# 4387406 Taqman single gene expression qPCR Mastermix ThermoFisher Cat# 4440040 Mouse Tumor Dissociation Kit Miltenyi Biotec Cat# 130-096-730 Human Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 EasySep Mouse CD8 + T Cell Isolation Kit Stemcell Technologies Cat# 19853 P3 Primary Cell 4D Nucleofector X Kit S Lonza Cat# V4XP-3032 Alt-R Sp Cas9 Nuclease V3 IDT Cat# 1081059 ISRIB Sigma Aldrich Cat# SML0843 eBioscience Annexin V-FITC Apoptosis Detection Kit ThermoFisher Cat# 88-8103-72 eBioscience BrdU Staining Kit for Flow Cytometry APC ThermoFisher Cat# 8817-6600-42 GSK2606414 (PERKi) Selleckchem Cat# S7307 GCN2iB Selleckchem Cat# S8929 PKR-IN-C16 Selleckchem Cat# S9668 Mouse T cell Activator CD3/CD28 Dynabeads ThermoFisher Cat# 11452D Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat# RPN2232 OPAL 6-plex detection kit Akoya Cat# NEL8710011KT Bond dewax solution Leica Cat# AR9222 (Continued on next page) e2 Immunity 58, 1–16.e1–e8, October 14, 2025 .. E8Icre (C57BL/6-Tg(Cd8a-cre)1Itan/J), ATF4 Tg/Tg (C57BL/6;129X1-Gt(ROSA)26Sor tm2(ATF4)Myz /J), ATF4 f/f (C57BL/6-Atf4 tm1.1Cmad /J), OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J), CD45.1 (C57BL/6.SJL-Ptprc a Pepc b /BoyJ), and C57BL/6 mice were obtained from Jackson Laboratories.
Gene Expression:Article Title: Intra-tumoral hypoxia promotes CD8 + T cell dysfunction via chronic activation of integrated stress response transcription factor ATF4.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Human pleomorphic undifferentiated high-grade deep sarcomas University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Human blood (matched to tumor) University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Chemical, peptide and recombinant proteins Recombinant human IL-2 NCI: Biological Resources Branch Ro 23-6019 GolgiPlug Protein Transport Inhibitor (Brefeldin A) BD Biosciences Cat# 51-2301KZ Cell Stimulation Cocktail ThermoFisher Cat# 00-4970-93 Pierce RIPA Buffer Thermo Scientific Cat# 89900 Protease Inhibitor Cocktail Cell Signaling Technology Cat# 5871 Phosphatase Inhibitor Cocktail I Sigma Aldrich Cat# P2850 Phosphatase Inhibitor Cocktail II Sigma Aldrich Cat# P5726 OVA peptide (OVA 257-267) InvivoGen Cat# vac-sin Geneticin Selective Antibiotic ThermoFisher Cat# 10131-035 Seahorse XF DMEM Medium, pH 7.4 Agilent Cat# 103575-100 CellTak Cell and Tissue Adhesive Corning Cat# 354240 Histopaque-1077 Sigma Aldrich Cat# 10771 N-acetyl-L-cysteine Sigma Aldrich Cat# A9165 Percoll Cytiva Cat# 17089101 Critical commercial assays UltraComp eBeads Plus Compensation Beads ThermoFisher Cat# 1333342 Foxp3/Transcription Factor Fixation/ Permeabilization Kit ThermoFisher Cat# 00-5521-00 Pierce BCA Protein Assay Kit ThermoFisher Cat# 23225 Seahorse XFe96 FluxPak Mini Agilent Technologies Cat# 102601-100 Zombie NIR Viability Stain Biolegend Cat# 420106 MitoSox Mitochondrial Superoxide Indicator ThermoFisher Cat# M36008 RNeasy RNA Isolation Kit Qiagen Cat# 74104 High Capacity RNA-to-cDNA Kit ThermoFisher Cat# 4387406 Taqman single gene expression qPCR Mastermix ThermoFisher Cat# 4440040 Mouse Tumor Dissociation Kit Miltenyi Biotec Cat# 130-096-730 Human Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 EasySep Mouse CD8 + T Cell Isolation Kit Stemcell Technologies Cat# 19853 P3 Primary Cell 4D Nucleofector X Kit S Lonza Cat# V4XP-3032 Alt-R Sp Cas9 Nuclease V3 IDT Cat# 1081059 ISRIB Sigma Aldrich Cat# SML0843 eBioscience Annexin V-FITC Apoptosis Detection Kit ThermoFisher Cat# 88-8103-72 eBioscience BrdU Staining Kit for Flow Cytometry APC ThermoFisher Cat# 8817-6600-42 GSK2606414 (PERKi) Selleckchem Cat# S7307 GCN2iB Selleckchem Cat# S8929 PKR-IN-C16 Selleckchem Cat# S9668 Mouse T cell Activator CD3/CD28 Dynabeads ThermoFisher Cat# 11452D Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat# RPN2232 OPAL 6-plex detection kit Akoya Cat# NEL8710011KT Bond dewax solution Leica Cat# AR9222 (Continued on next page) e2 Immunity 58, 1–16.e1–e8, October 14, 2025 .. E8Icre (C57BL/6-Tg(Cd8a-cre)1Itan/J), ATF4 Tg/Tg (C57BL/6;129X1-Gt(ROSA)26Sor tm2(ATF4)Myz /J), ATF4 f/f (C57BL/6-Atf4 tm1.1Cmad /J), OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J), CD45.1 (C57BL/6.SJL-Ptprc a Pepc b /BoyJ), and C57BL/6 mice were obtained from Jackson Laboratories.
BrdU Staining:Article Title: Intra-tumoral hypoxia promotes CD8 + T cell dysfunction via chronic activation of integrated stress response transcription factor ATF4.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Human pleomorphic undifferentiated high-grade deep sarcomas University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Human blood (matched to tumor) University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Chemical, peptide and recombinant proteins Recombinant human IL-2 NCI: Biological Resources Branch Ro 23-6019 GolgiPlug Protein Transport Inhibitor (Brefeldin A) BD Biosciences Cat# 51-2301KZ Cell Stimulation Cocktail ThermoFisher Cat# 00-4970-93 Pierce RIPA Buffer Thermo Scientific Cat# 89900 Protease Inhibitor Cocktail Cell Signaling Technology Cat# 5871 Phosphatase Inhibitor Cocktail I Sigma Aldrich Cat# P2850 Phosphatase Inhibitor Cocktail II Sigma Aldrich Cat# P5726 OVA peptide (OVA 257-267) InvivoGen Cat# vac-sin Geneticin Selective Antibiotic ThermoFisher Cat# 10131-035 Seahorse XF DMEM Medium, pH 7.4 Agilent Cat# 103575-100 CellTak Cell and Tissue Adhesive Corning Cat# 354240 Histopaque-1077 Sigma Aldrich Cat# 10771 N-acetyl-L-cysteine Sigma Aldrich Cat# A9165 Percoll Cytiva Cat# 17089101 Critical commercial assays UltraComp eBeads Plus Compensation Beads ThermoFisher Cat# 1333342 Foxp3/Transcription Factor Fixation/ Permeabilization Kit ThermoFisher Cat# 00-5521-00 Pierce BCA Protein Assay Kit ThermoFisher Cat# 23225 Seahorse XFe96 FluxPak Mini Agilent Technologies Cat# 102601-100 Zombie NIR Viability Stain Biolegend Cat# 420106 MitoSox Mitochondrial Superoxide Indicator ThermoFisher Cat# M36008 RNeasy RNA Isolation Kit Qiagen Cat# 74104 High Capacity RNA-to-cDNA Kit ThermoFisher Cat# 4387406 Taqman single gene expression qPCR Mastermix ThermoFisher Cat# 4440040 Mouse Tumor Dissociation Kit Miltenyi Biotec Cat# 130-096-730 Human Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 EasySep Mouse CD8 + T Cell Isolation Kit Stemcell Technologies Cat# 19853 P3 Primary Cell 4D Nucleofector X Kit S Lonza Cat# V4XP-3032 Alt-R Sp Cas9 Nuclease V3 IDT Cat# 1081059 ISRIB Sigma Aldrich Cat# SML0843 eBioscience Annexin V-FITC Apoptosis Detection Kit ThermoFisher Cat# 88-8103-72 eBioscience BrdU Staining Kit for Flow Cytometry APC ThermoFisher Cat# 8817-6600-42 GSK2606414 (PERKi) Selleckchem Cat# S7307 GCN2iB Selleckchem Cat# S8929 PKR-IN-C16 Selleckchem Cat# S9668 Mouse T cell Activator CD3/CD28 Dynabeads ThermoFisher Cat# 11452D Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat# RPN2232 OPAL 6-plex detection kit Akoya Cat# NEL8710011KT Bond dewax solution Leica Cat# AR9222 (Continued on next page) e2 Immunity 58, 1–16.e1–e8, October 14, 2025 .. E8Icre (C57BL/6-Tg(Cd8a-cre)1Itan/J), ATF4 Tg/Tg (C57BL/6;129X1-Gt(ROSA)26Sor tm2(ATF4)Myz /J), ATF4 f/f (C57BL/6-Atf4 tm1.1Cmad /J), OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J), CD45.1 (C57BL/6.SJL-Ptprc a Pepc b /BoyJ), and C57BL/6 mice were obtained from Jackson Laboratories.
Flow Cytometry:Article Title: Intra-tumoral hypoxia promotes CD8 + T cell dysfunction via chronic activation of integrated stress response transcription factor ATF4.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Human pleomorphic undifferentiated high-grade deep sarcomas University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Human blood (matched to tumor) University of North Carolina at Chapel Hill IRB protocol: LCCC9001 Chemical, peptide and recombinant proteins Recombinant human IL-2 NCI: Biological Resources Branch Ro 23-6019 GolgiPlug Protein Transport Inhibitor (Brefeldin A) BD Biosciences Cat# 51-2301KZ Cell Stimulation Cocktail ThermoFisher Cat# 00-4970-93 Pierce RIPA Buffer Thermo Scientific Cat# 89900 Protease Inhibitor Cocktail Cell Signaling Technology Cat# 5871 Phosphatase Inhibitor Cocktail I Sigma Aldrich Cat# P2850 Phosphatase Inhibitor Cocktail II Sigma Aldrich Cat# P5726 OVA peptide (OVA 257-267) InvivoGen Cat# vac-sin Geneticin Selective Antibiotic ThermoFisher Cat# 10131-035 Seahorse XF DMEM Medium, pH 7.4 Agilent Cat# 103575-100 CellTak Cell and Tissue Adhesive Corning Cat# 354240 Histopaque-1077 Sigma Aldrich Cat# 10771 N-acetyl-L-cysteine Sigma Aldrich Cat# A9165 Percoll Cytiva Cat# 17089101 Critical commercial assays UltraComp eBeads Plus Compensation Beads ThermoFisher Cat# 1333342 Foxp3/Transcription Factor Fixation/ Permeabilization Kit ThermoFisher Cat# 00-5521-00 Pierce BCA Protein Assay Kit ThermoFisher Cat# 23225 Seahorse XFe96 FluxPak Mini Agilent Technologies Cat# 102601-100 Zombie NIR Viability Stain Biolegend Cat# 420106 MitoSox Mitochondrial Superoxide Indicator ThermoFisher Cat# M36008 RNeasy RNA Isolation Kit Qiagen Cat# 74104 High Capacity RNA-to-cDNA Kit ThermoFisher Cat# 4387406 Taqman single gene expression qPCR Mastermix ThermoFisher Cat# 4440040 Mouse Tumor Dissociation Kit Miltenyi Biotec Cat# 130-096-730 Human Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 EasySep Mouse CD8 + T Cell Isolation Kit Stemcell Technologies Cat# 19853 P3 Primary Cell 4D Nucleofector X Kit S Lonza Cat# V4XP-3032 Alt-R Sp Cas9 Nuclease V3 IDT Cat# 1081059 ISRIB Sigma Aldrich Cat# SML0843 eBioscience Annexin V-FITC Apoptosis Detection Kit ThermoFisher Cat# 88-8103-72 eBioscience BrdU Staining Kit for Flow Cytometry APC ThermoFisher Cat# 8817-6600-42 GSK2606414 (PERKi) Selleckchem Cat# S7307 GCN2iB Selleckchem Cat# S8929 PKR-IN-C16 Selleckchem Cat# S9668 Mouse T cell Activator CD3/CD28 Dynabeads ThermoFisher Cat# 11452D Amersham ECL Prime Western Blotting Detection Reagent Cytiva Cat# RPN2232 OPAL 6-plex detection kit Akoya Cat# NEL8710011KT Bond dewax solution Leica Cat# AR9222 (Continued on next page) e2 Immunity 58, 1–16.e1–e8, October 14, 2025 .. E8Icre (C57BL/6-Tg(Cd8a-cre)1Itan/J), ATF4 Tg/Tg (C57BL/6;129X1-Gt(ROSA)26Sor tm2(ATF4)Myz /J), ATF4 f/f (C57BL/6-Atf4 tm1.1Cmad /J), OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J), CD45.1 (C57BL/6.SJL-Ptprc a Pepc b /BoyJ), and C57BL/6 mice were obtained from Jackson Laboratories.
|
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 